Incidental Mutation 'R2962:Plekhg3'
ID255932
Institutional Source Beutler Lab
Gene Symbol Plekhg3
Ensembl Gene ENSMUSG00000052609
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 3
SynonymsMGC40768
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2962 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76530891-76580488 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 76572659 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075249] [ENSMUST00000219063]
Predicted Effect probably null
Transcript: ENSMUST00000075249
SMART Domains Protein: ENSMUSP00000074729
Gene: ENSMUSG00000052609

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
RhoGEF 97 271 6.67e-51 SMART
PH 297 396 2.48e-9 SMART
coiled coil region 515 552 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 978 993 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218461
Predicted Effect possibly damaging
Transcript: ENSMUST00000219063
AA Change: V557I

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219426
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd24a A G 10: 43,579,317 T22A probably benign Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cog3 A G 14: 75,740,534 probably null Het
Gm3371 A T 14: 44,408,698 N103K probably benign Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hoxc10 A G 15: 102,967,300 Y148C probably damaging Het
Jade1 C G 3: 41,613,327 T610S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Malt1 A G 18: 65,448,335 H278R probably benign Het
Mlxip C A 5: 123,440,824 R178S probably damaging Het
Olfr539 A T 7: 140,667,949 M214L probably benign Het
Pdxk A G 10: 78,443,833 L236P probably damaging Het
Rufy2 G T 10: 63,000,260 V323F probably damaging Het
Serpinb7 A G 1: 107,451,726 T288A probably benign Het
Tet1 A T 10: 62,814,544 C1628* probably null Het
Tgtp2 A G 11: 49,059,536 S70P probably damaging Het
Tmem211 T C 5: 113,238,056 V123A possibly damaging Het
Trank1 C T 9: 111,352,080 T390I probably damaging Het
Trim31 T C 17: 36,899,904 S143P probably damaging Het
Ube3c C A 5: 29,658,418 A897D possibly damaging Het
Unc79 A T 12: 103,095,119 T1050S possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Plekhg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Plekhg3 APN 12 76562278 missense probably damaging 0.99
IGL01143:Plekhg3 APN 12 76564982 critical splice donor site probably null
IGL02079:Plekhg3 APN 12 76560429 missense probably benign 0.01
IGL02349:Plekhg3 APN 12 76562300 missense probably damaging 1.00
IGL02442:Plekhg3 APN 12 76578353 missense probably benign 0.01
IGL02570:Plekhg3 APN 12 76578245 missense probably benign
flagging UTSW 12 76560520 critical splice donor site probably null
trailing UTSW 12 76564961 missense probably benign 0.15
R0344:Plekhg3 UTSW 12 76566266 nonsense probably null
R0667:Plekhg3 UTSW 12 76576598 missense probably damaging 1.00
R1269:Plekhg3 UTSW 12 76560469 missense probably damaging 1.00
R1566:Plekhg3 UTSW 12 76572065 missense possibly damaging 0.54
R1905:Plekhg3 UTSW 12 76576217 missense probably benign 0.05
R2885:Plekhg3 UTSW 12 76564961 missense probably benign 0.15
R3784:Plekhg3 UTSW 12 76560520 critical splice donor site probably null
R3941:Plekhg3 UTSW 12 76573359 missense probably damaging 0.98
R4056:Plekhg3 UTSW 12 76565247 missense probably damaging 1.00
R4080:Plekhg3 UTSW 12 76577981 missense probably benign 0.02
R4412:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4413:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4704:Plekhg3 UTSW 12 76578238 missense probably damaging 1.00
R4720:Plekhg3 UTSW 12 76578322 missense possibly damaging 0.59
R4738:Plekhg3 UTSW 12 76576914 missense probably damaging 1.00
R4898:Plekhg3 UTSW 12 76564125 missense probably damaging 1.00
R4994:Plekhg3 UTSW 12 76565537 missense possibly damaging 0.68
R4999:Plekhg3 UTSW 12 76565247 missense possibly damaging 0.95
R5484:Plekhg3 UTSW 12 76578400 missense possibly damaging 0.76
R5591:Plekhg3 UTSW 12 76560292 missense possibly damaging 0.80
R6019:Plekhg3 UTSW 12 76577941 nonsense probably null
R6147:Plekhg3 UTSW 12 76565211 missense probably damaging 0.96
R6272:Plekhg3 UTSW 12 76576845 missense probably benign 0.00
R6482:Plekhg3 UTSW 12 76576004 missense probably benign 0.01
R7081:Plekhg3 UTSW 12 76578245 missense probably benign
X0062:Plekhg3 UTSW 12 76573343 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGAGCCCTCTTGGACTTTG -3'
(R):5'- TGAGTTAAGTATTGACGGCAGG -3'

Sequencing Primer
(F):5'- CCCTCTTGGACTTTGGGCAG -3'
(R):5'- TTAAGTATTGACGGCAGGAAGGAG -3'
Posted On2014-12-29