Incidental Mutation 'R2963:Or4f62'
ID 255941
Institutional Source Beutler Lab
Gene Symbol Or4f62
Ensembl Gene ENSMUSG00000049758
Gene Name olfactory receptor family 4 subfamily F member 62
Synonyms MOR245-16, GA_x6K02T2Q125-73202172-73203134, Olfr1318
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R2963 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111986243-111987352 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 111986804 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 169 (C169*)
Ref Sequence ENSEMBL: ENSMUSP00000151164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058176] [ENSMUST00000214063] [ENSMUST00000217533]
AlphaFold Q7TQW6
Predicted Effect probably null
Transcript: ENSMUST00000058176
AA Change: C169*
SMART Domains Protein: ENSMUSP00000051938
Gene: ENSMUSG00000049758
AA Change: C169*

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 2.4e-39 PFAM
Pfam:7tm_1 41 287 1.5e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214063
AA Change: C169*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216873
Predicted Effect probably null
Transcript: ENSMUST00000217533
AA Change: C169*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam T C 16: 52,115,404 (GRCm39) E238G probably benign Het
Angptl4 G A 17: 33,996,008 (GRCm39) P323S possibly damaging Het
Capn13 C T 17: 73,622,258 (GRCm39) probably null Het
Cdk5rap2 ATGTG ATG 4: 70,208,214 (GRCm39) probably null Het
Cyfip1 T C 7: 55,544,783 (GRCm39) F472L probably damaging Het
Cyp2t4 T C 7: 26,854,699 (GRCm39) S60P possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ptpn18 C T 1: 34,510,773 (GRCm39) Q246* probably null Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Zfr G A 15: 12,162,319 (GRCm39) R823H probably benign Het
Other mutations in Or4f62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Or4f62 APN 2 111,986,412 (GRCm39) missense probably benign
IGL00923:Or4f62 APN 2 111,987,122 (GRCm39) missense possibly damaging 0.75
IGL02800:Or4f62 APN 2 111,986,589 (GRCm39) missense possibly damaging 0.95
R0012:Or4f62 UTSW 2 111,987,171 (GRCm39) missense possibly damaging 0.84
R1614:Or4f62 UTSW 2 111,986,862 (GRCm39) missense probably damaging 1.00
R1989:Or4f62 UTSW 2 111,986,722 (GRCm39) missense probably benign 0.00
R2428:Or4f62 UTSW 2 111,986,787 (GRCm39) missense probably benign 0.03
R4868:Or4f62 UTSW 2 111,986,916 (GRCm39) missense probably damaging 0.99
R4960:Or4f62 UTSW 2 111,986,697 (GRCm39) missense probably benign 0.00
R5121:Or4f62 UTSW 2 111,986,631 (GRCm39) missense possibly damaging 0.47
R6218:Or4f62 UTSW 2 111,986,701 (GRCm39) missense probably damaging 0.99
R6294:Or4f62 UTSW 2 111,986,364 (GRCm39) missense probably benign
R6350:Or4f62 UTSW 2 111,986,542 (GRCm39) missense probably damaging 0.99
R6515:Or4f62 UTSW 2 111,986,710 (GRCm39) missense probably benign 0.00
R6722:Or4f62 UTSW 2 111,987,227 (GRCm39) missense probably benign
R6829:Or4f62 UTSW 2 111,986,139 (GRCm39) intron probably benign
R7186:Or4f62 UTSW 2 111,986,507 (GRCm39) missense probably damaging 1.00
R7206:Or4f62 UTSW 2 111,986,804 (GRCm39) missense probably damaging 1.00
R7444:Or4f62 UTSW 2 111,987,060 (GRCm39) missense probably damaging 1.00
R8293:Or4f62 UTSW 2 111,986,598 (GRCm39) missense probably benign 0.07
R8474:Or4f62 UTSW 2 111,986,320 (GRCm39) missense probably benign
R8712:Or4f62 UTSW 2 111,986,934 (GRCm39) missense probably damaging 1.00
R8749:Or4f62 UTSW 2 111,986,869 (GRCm39) missense possibly damaging 0.60
R8888:Or4f62 UTSW 2 111,986,974 (GRCm39) missense probably benign 0.00
R9223:Or4f62 UTSW 2 111,986,473 (GRCm39) missense possibly damaging 0.58
R9406:Or4f62 UTSW 2 111,986,643 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGTTGCTCATAGTCATGGCC -3'
(R):5'- CCACAGTGATGTGAGCTGAGAG -3'

Sequencing Primer
(F):5'- CCTATGACAGGTACATTGCTATCTG -3'
(R):5'- CACCTGAGGAGTGTTTACGAACTG -3'
Posted On 2014-12-29