Mutagenetix > Incidental Mutation

Incidental Mutation 'R2963:Nfix'

255945

Institutional Source

Beutler Lab

Gene Symbol

Nfix

Ensembl Gene

ENSMUSG00000001911

Gene Name

nuclear factor I/X

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R2963 (G1)

Quality Score

105

Status

Not validated

Chromosome

Chromosomal Location

85431341-85527086 bp(-) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

CAAAAA to CAAAA at 85442876 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000076715

SMART Domains

Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.1e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	322	7.4e-32	PFAM
Pfam:CTF_NFI	313	396	3.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099070

SMART Domains

Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.7e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	437	2.7e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109762

SMART Domains

Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1.1e-27	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	312	5.4e-32	PFAM
Pfam:CTF_NFI	305	387	3.6e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000109764

SMART Domains

Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1e-28	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	494	9.8e-137	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000126806

SMART Domains

Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	7.1e-31	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	488	1.5e-83	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132236

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 10 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alcam	T	C	16: 52,115,404 (GRCm39)	E238G	probably benign	Het
Angptl4	G	A	17: 33,996,008 (GRCm39)	P323S	possibly damaging	Het
Capn13	C	T	17: 73,622,258 (GRCm39)		probably null	Het
Cdk5rap2	ATGTG	ATG	4: 70,208,214 (GRCm39)		probably null	Het
Cyfip1	T	C	7: 55,544,783 (GRCm39)	F472L	probably damaging	Het
Cyp2t4	T	C	7: 26,854,699 (GRCm39)	S60P	possibly damaging	Het
Or4f62	T	A	2: 111,986,804 (GRCm39)	C169*	probably null	Het
Ptpn18	C	T	1: 34,510,773 (GRCm39)	Q246*	probably null	Het
Tex11	C	A	X: 99,977,021 (GRCm39)	A487S	possibly damaging	Het
Zfr	G	A	15: 12,162,319 (GRCm39)	R823H	probably benign	Het

Other mutations in Nfix

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Nfix	APN	8	85,453,106 (GRCm39)	missense	probably damaging	0.99
IGL01919:Nfix	APN	8	85,453,103 (GRCm39)	missense	probably damaging	1.00
IGL01950:Nfix	APN	8	85,440,415 (GRCm39)	makesense	probably null
IGL02862:Nfix	APN	8	85,440,475 (GRCm39)	missense	probably benign	0.07
R0142:Nfix	UTSW	8	85,448,315 (GRCm39)	missense	probably damaging	1.00
R0309:Nfix	UTSW	8	85,448,403 (GRCm39)	missense	probably damaging	1.00
R0600:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R0622:Nfix	UTSW	8	85,453,111 (GRCm39)	missense	probably damaging	0.99
R0628:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R0882:Nfix	UTSW	8	85,454,554 (GRCm39)	missense	probably damaging	1.00
R0893:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R0974:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R0975:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1014:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1015:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1162:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1241:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1381:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1513:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1521:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1618:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R1865:Nfix	UTSW	8	85,498,904 (GRCm39)	missense	possibly damaging	0.73
R1912:Nfix	UTSW	8	85,448,306 (GRCm39)	missense	probably damaging	1.00
R1974:Nfix	UTSW	8	85,453,155 (GRCm39)	missense	probably damaging	1.00
R2208:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R2251:Nfix	UTSW	8	85,442,799 (GRCm39)	missense	probably benign	0.03
R2268:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R2270:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R2272:Nfix	UTSW	8	85,453,804 (GRCm39)	missense	probably damaging	1.00
R2346:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R2350:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R2983:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R3008:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R3727:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R3791:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R4163:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R4164:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R4201:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R4206:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R4609:Nfix	UTSW	8	85,453,119 (GRCm39)	missense	probably damaging	1.00
R4801:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R4802:Nfix	UTSW	8	85,442,876 (GRCm39)	frame shift	probably null
R4914:Nfix	UTSW	8	85,498,458 (GRCm39)	missense	probably benign	0.00
R4915:Nfix	UTSW	8	85,498,458 (GRCm39)	missense	probably benign	0.00
R4916:Nfix	UTSW	8	85,498,458 (GRCm39)	missense	probably benign	0.00
R4918:Nfix	UTSW	8	85,498,458 (GRCm39)	missense	probably benign	0.00
R5013:Nfix	UTSW	8	85,498,713 (GRCm39)	missense	possibly damaging	0.86
R5290:Nfix	UTSW	8	85,440,406 (GRCm39)	nonsense	probably null
R6418:Nfix	UTSW	8	85,453,778 (GRCm39)	missense	probably benign	0.01
R6554:Nfix	UTSW	8	85,454,279 (GRCm39)	missense	possibly damaging	0.93
R6786:Nfix	UTSW	8	85,454,276 (GRCm39)	missense	probably damaging	1.00
R8853:Nfix	UTSW	8	85,454,276 (GRCm39)	missense	probably damaging	1.00
R9014:Nfix	UTSW	8	85,448,405 (GRCm39)	missense	possibly damaging	0.95
T0970:Nfix	UTSW	8	85,453,112 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCTGGCTGGAGTAACTGAG -3'
(R):5'- CTGTGCCTAGAGGAAAGGAC -3'

Sequencing Primer
(F):5'- CCTCTCTTTGCAGTGGAGAC -3'
(R):5'- GAGGAAAGGACCCTCCCTC -3'

Posted On

2014-12-29