Mutagenetix > Incidental Mutation

Incidental Mutation 'R2963:Capn13'

255949

Institutional Source

Beutler Lab

Gene Symbol

Capn13

Ensembl Gene

ENSMUSG00000043705

Gene Name

calpain 13

Synonyms

LOC381122

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R2963 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73613451-73706376 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 73622258 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000092832 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095208]

AlphaFold

Q3UW68

Predicted Effect

probably null
Transcript: ENSMUST00000095208

SMART Domains

Protein: ENSMUSP00000092832
Gene: ENSMUSG00000043705

Domain	Start	End	E-Value	Type
CysPc	12	337	3.23e-113	SMART
Pfam:Calpain_III	341	473	2e-13	PFAM
SCOP:d1k94a_	512	664	3e-8	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 10 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alcam	T	C	16: 52,115,404 (GRCm39)	E238G	probably benign	Het
Angptl4	G	A	17: 33,996,008 (GRCm39)	P323S	possibly damaging	Het
Cdk5rap2	ATGTG	ATG	4: 70,208,214 (GRCm39)		probably null	Het
Cyfip1	T	C	7: 55,544,783 (GRCm39)	F472L	probably damaging	Het
Cyp2t4	T	C	7: 26,854,699 (GRCm39)	S60P	possibly damaging	Het
Nfix	CAAAAA	CAAAA	8: 85,442,876 (GRCm39)		probably null	Het
Or4f62	T	A	2: 111,986,804 (GRCm39)	C169*	probably null	Het
Ptpn18	C	T	1: 34,510,773 (GRCm39)	Q246*	probably null	Het
Tex11	C	A	X: 99,977,021 (GRCm39)	A487S	possibly damaging	Het
Zfr	G	A	15: 12,162,319 (GRCm39)	R823H	probably benign	Het

Other mutations in Capn13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Capn13	APN	17	73,646,420 (GRCm39)	missense	possibly damaging	0.82
IGL01099:Capn13	APN	17	73,658,504 (GRCm39)	missense	probably damaging	0.99
IGL01613:Capn13	APN	17	73,638,053 (GRCm39)	missense	probably benign	0.07
IGL02215:Capn13	APN	17	73,637,993 (GRCm39)	missense	probably damaging	1.00
IGL02403:Capn13	APN	17	73,658,421 (GRCm39)	missense	possibly damaging	0.82
IGL02877:Capn13	APN	17	73,629,050 (GRCm39)	missense	probably damaging	0.97
IGL03113:Capn13	APN	17	73,638,108 (GRCm39)	missense	probably benign	0.00
IGL03246:Capn13	APN	17	73,689,855 (GRCm39)	missense	probably benign
IGL03369:Capn13	APN	17	73,648,149 (GRCm39)	splice site	probably benign
R0116:Capn13	UTSW	17	73,658,519 (GRCm39)	missense	probably damaging	1.00
R0729:Capn13	UTSW	17	73,629,064 (GRCm39)	missense	probably damaging	1.00
R0745:Capn13	UTSW	17	73,658,503 (GRCm39)	missense	probably benign	0.39
R0746:Capn13	UTSW	17	73,658,503 (GRCm39)	missense	probably benign	0.39
R0778:Capn13	UTSW	17	73,658,503 (GRCm39)	missense	probably benign	0.39
R1252:Capn13	UTSW	17	73,674,222 (GRCm39)	missense	possibly damaging	0.80
R1594:Capn13	UTSW	17	73,658,474 (GRCm39)	missense	probably benign	0.15
R1641:Capn13	UTSW	17	73,689,889 (GRCm39)	missense	possibly damaging	0.91
R1895:Capn13	UTSW	17	73,657,520 (GRCm39)	missense	possibly damaging	0.50
R1902:Capn13	UTSW	17	73,633,356 (GRCm39)	missense	probably damaging	1.00
R1946:Capn13	UTSW	17	73,657,520 (GRCm39)	missense	possibly damaging	0.50
R2184:Capn13	UTSW	17	73,672,943 (GRCm39)	missense	probably damaging	1.00
R2427:Capn13	UTSW	17	73,633,312 (GRCm39)	splice site	probably benign
R3755:Capn13	UTSW	17	73,638,114 (GRCm39)	nonsense	probably null
R3759:Capn13	UTSW	17	73,629,072 (GRCm39)	missense	probably benign	0.01
R3795:Capn13	UTSW	17	73,644,387 (GRCm39)	missense	probably benign	0.14
R3801:Capn13	UTSW	17	73,646,396 (GRCm39)	missense	probably benign	0.00
R3802:Capn13	UTSW	17	73,646,396 (GRCm39)	missense	probably benign	0.00
R3803:Capn13	UTSW	17	73,646,396 (GRCm39)	missense	probably benign	0.00
R3804:Capn13	UTSW	17	73,646,396 (GRCm39)	missense	probably benign	0.00
R4084:Capn13	UTSW	17	73,644,444 (GRCm39)	missense	probably benign	0.00
R4194:Capn13	UTSW	17	73,646,479 (GRCm39)	missense	possibly damaging	0.48
R4326:Capn13	UTSW	17	73,638,103 (GRCm39)	missense	probably benign
R4788:Capn13	UTSW	17	73,644,427 (GRCm39)	nonsense	probably null
R4852:Capn13	UTSW	17	73,658,501 (GRCm39)	frame shift	probably null
R4853:Capn13	UTSW	17	73,658,501 (GRCm39)	frame shift	probably null
R4855:Capn13	UTSW	17	73,658,501 (GRCm39)	frame shift	probably null
R5063:Capn13	UTSW	17	73,629,074 (GRCm39)	nonsense	probably null
R5112:Capn13	UTSW	17	73,658,501 (GRCm39)	frame shift	probably null
R5438:Capn13	UTSW	17	73,633,479 (GRCm39)	missense	probably benign
R5955:Capn13	UTSW	17	73,637,997 (GRCm39)	missense	possibly damaging	0.92
R6408:Capn13	UTSW	17	73,672,954 (GRCm39)	nonsense	probably null
R6512:Capn13	UTSW	17	73,689,985 (GRCm39)	missense	probably benign	0.44
R7425:Capn13	UTSW	17	73,625,053 (GRCm39)	missense	probably benign	0.13
R7605:Capn13	UTSW	17	73,652,132 (GRCm39)	critical splice donor site	probably null
R7678:Capn13	UTSW	17	73,622,300 (GRCm39)	missense	probably damaging	1.00
R7776:Capn13	UTSW	17	73,629,049 (GRCm39)	missense	probably benign	0.07
R7791:Capn13	UTSW	17	73,689,883 (GRCm39)	missense	possibly damaging	0.88
R8087:Capn13	UTSW	17	73,623,279 (GRCm39)	missense	probably damaging	1.00
R8090:Capn13	UTSW	17	73,689,849 (GRCm39)	missense	probably benign	0.07
R8122:Capn13	UTSW	17	73,674,205 (GRCm39)	missense	probably damaging	1.00
R8169:Capn13	UTSW	17	73,633,467 (GRCm39)	splice site	probably null
R8927:Capn13	UTSW	17	73,631,761 (GRCm39)	splice site	probably null
R9193:Capn13	UTSW	17	73,652,191 (GRCm39)	missense	probably damaging	1.00
R9299:Capn13	UTSW	17	73,633,467 (GRCm39)	splice site	probably null
R9337:Capn13	UTSW	17	73,633,467 (GRCm39)	splice site	probably null
R9497:Capn13	UTSW	17	73,633,362 (GRCm39)	missense	probably benign	0.08
R9509:Capn13	UTSW	17	73,644,446 (GRCm39)	missense	probably benign	0.10
R9616:Capn13	UTSW	17	73,672,964 (GRCm39)	missense	probably benign	0.40
Z1176:Capn13	UTSW	17	73,648,105 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCATTTGGCCTTGAAACTCAG -3'
(R):5'- AACTGGCTTTAAGAATTGGTTCCAC -3'

Sequencing Primer
(F):5'- GCCTTGAAACTCAGGAGCAAG -3'
(R):5'- ATCCCTGAAATGTGATGGCC -3'

Posted On

2014-12-29