Incidental Mutation 'R2964:Mnd1'
ID255959
Institutional Source Beutler Lab
Gene Symbol Mnd1
Ensembl Gene ENSMUSG00000033752
Gene Namemeiotic nuclear divisions 1
Synonyms2610034E18Rik
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location84087933-84155786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84134109 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 62 (C62F)
Ref Sequence ENSEMBL: ENSMUSP00000048262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047368]
Predicted Effect probably benign
Transcript: ENSMUST00000047368
AA Change: C62F

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048262
Gene: ENSMUSG00000033752
AA Change: C62F

DomainStartEndE-ValueType
Pfam:Penicillinase_R 10 129 6.9e-8 PFAM
Pfam:Mnd1 16 202 1.7e-76 PFAM
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of the MND1 gene associates with HOP2 (MIM 608665) to form a stable heterodimeric complex that binds DNA and stimulates the recombinase activity of RAD51 (MIM 179617) and DMC1 (MIM 602721) (Chi et al., 2007 [PubMed 17639080]). Both the MND1 and HOP2 genes are indispensable for meiotic recombination.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants for this allele display defects in homologous chromosome synapsis and double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Mnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Mnd1 APN 3 84138198 missense possibly damaging 0.95
IGL01355:Mnd1 APN 3 84116477 missense probably benign 0.00
IGL02413:Mnd1 APN 3 84116479 missense probably benign
IGL03303:Mnd1 APN 3 84104937 missense probably benign 0.00
trinidad UTSW 3 84134109 missense probably benign 0.30
R0569:Mnd1 UTSW 3 84104979 missense probably benign 0.36
R1564:Mnd1 UTSW 3 84116431 missense probably benign 0.41
R2208:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2211:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2965:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R3106:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R5496:Mnd1 UTSW 3 84088174 missense probably damaging 1.00
R6319:Mnd1 UTSW 3 84141764 missense possibly damaging 0.95
X0026:Mnd1 UTSW 3 84093558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAAGTTTAAGGGAAGCCACTG -3'
(R):5'- ATGTTTGCCTCATGAGCCCAG -3'

Sequencing Primer
(F):5'- TTTAAGGGAAGCCACTGACTGAG -3'
(R):5'- TGTGTCACACCTAGATGCCTAG -3'
Posted On2014-12-29