Incidental Mutation 'R2964:Asprv1'
ID255969
Institutional Source Beutler Lab
Gene Symbol Asprv1
Ensembl Gene ENSMUSG00000033508
Gene Nameaspartic peptidase, retroviral-like 1
SynonymsTaps, SASPase, TPA-induced aspartic proteinase-like, SASP, 2300003P22Rik
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86628164-86629710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86628366 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 65 (C65S)
Ref Sequence ENSEMBL: ENSMUSP00000046121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043400]
Predicted Effect probably damaging
Transcript: ENSMUST00000043400
AA Change: C65S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046121
Gene: ENSMUSG00000033508
AA Change: C65S

DomainStartEndE-ValueType
Pfam:Asp_protease 177 295 1.3e-8 PFAM
Pfam:Asp_protease_2 196 286 1.6e-10 PFAM
low complexity region 314 338 N/A INTRINSIC
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele develop fine skin wrinkles at the side of their body without any apparent epidermal differentiation defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Asprv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Asprv1 APN 6 86628918 missense probably damaging 0.99
quince UTSW 6 86628840 missense probably damaging 1.00
R0254:Asprv1 UTSW 6 86629095 missense probably damaging 1.00
R0311:Asprv1 UTSW 6 86628840 missense probably damaging 1.00
R1538:Asprv1 UTSW 6 86628636 nonsense probably null
R1661:Asprv1 UTSW 6 86628736 missense probably damaging 0.97
R1792:Asprv1 UTSW 6 86628372 missense possibly damaging 0.59
R2965:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R2966:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R4748:Asprv1 UTSW 6 86628423 missense probably damaging 0.98
R5600:Asprv1 UTSW 6 86629062 nonsense probably null
R5655:Asprv1 UTSW 6 86628482 missense probably benign 0.05
R5704:Asprv1 UTSW 6 86628550 missense probably damaging 1.00
R5715:Asprv1 UTSW 6 86628614 missense probably benign
R6259:Asprv1 UTSW 6 86628379 missense probably benign 0.05
R6899:Asprv1 UTSW 6 86628760 missense probably damaging 1.00
R7451:Asprv1 UTSW 6 86628948 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGGGTGGAGCTTCTAGAAC -3'
(R):5'- TGGTGGCATGATCCCAATGG -3'

Sequencing Primer
(F):5'- GGTGGAGCTTCTAGAACAAAGG -3'
(R):5'- CATGATCCCAATGGTTGAGGTCATC -3'
Posted On2014-12-29