Incidental Mutation 'R2964:H2-T22'
ID255988
Institutional Source Beutler Lab
Gene Symbol H2-T22
Ensembl Gene ENSMUSG00000056116
Gene Namehistocompatibility 2, T region locus 22
SynonymsH-2T22, H-2T17, H2-T17
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2964 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36037128-36042747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36040645 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 231 (L231S)
Ref Sequence ENSEMBL: ENSMUSP00000078927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058801] [ENSMUST00000077960] [ENSMUST00000080015] [ENSMUST00000097331] [ENSMUST00000173280]
Predicted Effect probably damaging
Transcript: ENSMUST00000058801
AA Change: L231S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056041
Gene: ENSMUSG00000056116
AA Change: L231S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 5.8e-47 PFAM
IGc1 210 281 2.06e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077960
AA Change: L231S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077111
Gene: ENSMUSG00000056116
AA Change: L231S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 4e-47 PFAM
IGc1 210 281 2.06e-23 SMART
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080015
AA Change: L231S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078927
Gene: ENSMUSG00000056116
AA Change: L231S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 7.3e-47 PFAM
IGc1 210 281 2.06e-23 SMART
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097331
SMART Domains Protein: ENSMUSP00000094943
Gene: ENSMUSG00000073407

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172633
Predicted Effect probably benign
Transcript: ENSMUST00000173280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173900
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in H2-T22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:H2-T22 APN 17 36041919 missense probably damaging 0.99
IGL02978:H2-T22 APN 17 36041625 missense probably benign 0.00
R0078:H2-T22 UTSW 17 36040609 missense probably damaging 0.99
R0448:H2-T22 UTSW 17 36042386 missense possibly damaging 0.96
R1402:H2-T22 UTSW 17 36040269 missense possibly damaging 0.95
R1402:H2-T22 UTSW 17 36040269 missense possibly damaging 0.95
R1592:H2-T22 UTSW 17 36041577 missense probably damaging 0.99
R1830:H2-T22 UTSW 17 36041542 missense probably benign 0.00
R2105:H2-T22 UTSW 17 36040517 missense probably benign 0.23
R2116:H2-T22 UTSW 17 36039057 splice site probably null
R2965:H2-T22 UTSW 17 36040645 missense probably damaging 1.00
R3425:H2-T22 UTSW 17 36041580 missense probably damaging 1.00
R3875:H2-T22 UTSW 17 36040303 missense probably benign 0.03
R4614:H2-T22 UTSW 17 36040537 missense probably benign 0.28
R4691:H2-T22 UTSW 17 36041570 frame shift probably null
R4870:H2-T22 UTSW 17 36039032 missense probably benign 0.00
R4954:H2-T22 UTSW 17 36041959 missense probably damaging 1.00
R5109:H2-T22 UTSW 17 36039221 nonsense probably null
R5995:H2-T22 UTSW 17 36041485 missense probably benign 0.18
Z1088:H2-T22 UTSW 17 36041638 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGGTCTACAGAAGGCTC -3'
(R):5'- ATGAACACTGCTGAGTCCC -3'

Sequencing Primer
(F):5'- AAGGCTCCAGCTTTCCCTGAAC -3'
(R):5'- TGCTGAGTCCCCAGAAGAAAGC -3'
Posted On2014-12-29