Incidental Mutation 'R2965:Ankar'
ID255996
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Nameankyrin and armadillo repeat containing
Synonyms4932422E22Rik
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location72642980-72700579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72675820 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 382 (I382V)
Ref Sequence ENSEMBL: ENSMUSP00000148640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
Predicted Effect probably benign
Transcript: ENSMUST00000053499
AA Change: I600V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: I600V

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211837
AA Change: I599V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000212573
AA Change: I382V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 intron probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGCTCCATAACTCACTCTG -3'
(R):5'- ATAGAGCTCTCAGGACCCAC -3'

Sequencing Primer
(F):5'- GCTGTTGCCTCGGCCTCTAG -3'
(R):5'- GACATGGGCCTGTTATACCAGCTAC -3'
Posted On2014-12-29