Incidental Mutation 'R2965:Add1'
ID256009
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Nameadducin 1 (alpha)
Synonyms
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34573664-34632308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34630714 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 702 (D702E)
Ref Sequence ENSEMBL: ENSMUSP00000109979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000001109] [ENSMUST00000052836] [ENSMUST00000114329] [ENSMUST00000114331] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000126257] [ENSMUST00000134156] [ENSMUST00000137150] [ENSMUST00000137506] [ENSMUST00000149657] [ENSMUST00000155577] [ENSMUST00000201147] [ENSMUST00000201810] [ENSMUST00000202378]
Predicted Effect probably benign
Transcript: ENSMUST00000001108
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001109
SMART Domains Protein: ENSMUSP00000001109
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.9e-41 PFAM
Pfam:Sugar_tr 62 235 7.9e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052836
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114329
SMART Domains Protein: ENSMUSP00000109968
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114331
SMART Domains Protein: ENSMUSP00000109970
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114335
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114338
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114340
AA Change: D702E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106
AA Change: D702E

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126257
SMART Domains Protein: ENSMUSP00000144630
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 139 5.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130347
Predicted Effect probably benign
Transcript: ENSMUST00000134156
SMART Domains Protein: ENSMUSP00000143812
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136010
Predicted Effect probably benign
Transcript: ENSMUST00000137150
SMART Domains Protein: ENSMUSP00000120814
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137262
Predicted Effect probably benign
Transcript: ENSMUST00000137506
SMART Domains Protein: ENSMUSP00000144121
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 31 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148270
Predicted Effect probably benign
Transcript: ENSMUST00000149657
SMART Domains Protein: ENSMUSP00000118786
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 261 1.3e-26 PFAM
Pfam:Sugar_tr 71 228 9.3e-10 PFAM
Pfam:TRI12 76 232 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151247
Predicted Effect probably benign
Transcript: ENSMUST00000152805
SMART Domains Protein: ENSMUSP00000121402
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 95 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155577
SMART Domains Protein: ENSMUSP00000115204
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 269 1.1e-27 PFAM
Pfam:Sugar_tr 71 228 9.6e-10 PFAM
Pfam:TRI12 76 232 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200717
Predicted Effect probably benign
Transcript: ENSMUST00000201147
SMART Domains Protein: ENSMUSP00000144239
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
low complexity region 80 95 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201810
SMART Domains Protein: ENSMUSP00000144673
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 142 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202065
Predicted Effect probably benign
Transcript: ENSMUST00000202378
SMART Domains Protein: ENSMUSP00000144117
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 24 43 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34613358 missense probably damaging 1.00
IGL01370:Add1 APN 5 34630515 missense probably damaging 1.00
IGL01670:Add1 APN 5 34620063 missense probably damaging 1.00
IGL02965:Add1 APN 5 34620123 missense probably damaging 0.99
IGL03178:Add1 APN 5 34614245 unclassified probably null
R0126:Add1 UTSW 5 34613579 missense probably benign 0.04
R0189:Add1 UTSW 5 34616648 missense probably benign 0.01
R0195:Add1 UTSW 5 34610646 unclassified probably benign
R0318:Add1 UTSW 5 34625340 missense probably damaging 0.99
R0605:Add1 UTSW 5 34614224 missense possibly damaging 0.87
R0624:Add1 UTSW 5 34605853 missense probably damaging 1.00
R1514:Add1 UTSW 5 34610617 missense probably benign 0.03
R1573:Add1 UTSW 5 34601396 missense possibly damaging 0.89
R2512:Add1 UTSW 5 34616686 missense probably benign 0.02
R2966:Add1 UTSW 5 34630714 missense probably benign 0.00
R5646:Add1 UTSW 5 34630680 missense probably benign 0.10
R5993:Add1 UTSW 5 34601533 missense probably damaging 1.00
R6356:Add1 UTSW 5 34619396 missense probably null 1.00
R6514:Add1 UTSW 5 34605973 missense probably damaging 1.00
R6536:Add1 UTSW 5 34601436 missense possibly damaging 0.89
R6659:Add1 UTSW 5 34613295 missense possibly damaging 0.94
R7326:Add1 UTSW 5 34619371 missense probably benign 0.32
Z1088:Add1 UTSW 5 34613400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATGCCACCACCTTCAAGC -3'
(R):5'- TCCATTACACAGGAGGATAGAAC -3'

Sequencing Primer
(F):5'- CTGACCTCTCCCCTGATGAG -3'
(R):5'- TTACACAGGAGGATAGAACACAAGAC -3'
Posted On2014-12-29