Incidental Mutation 'R2965:2610021A01Rik'
ID256016
Institutional Source Beutler Lab
Gene Symbol 2610021A01Rik
Ensembl Gene ENSMUSG00000091474
Gene NameRIKEN cDNA 2610021A01 gene
Synonyms
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41599230-41628533 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 41626405 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 511 (R511*)
Ref Sequence ENSEMBL: ENSMUSP00000127760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163475]
Predicted Effect probably null
Transcript: ENSMUST00000163475
AA Change: R511*
SMART Domains Protein: ENSMUSP00000127760
Gene: ENSMUSG00000091474
AA Change: R511*

DomainStartEndE-ValueType
KRAB 18 78 1.32e-32 SMART
ZnF_C2H2 415 437 4.54e-4 SMART
ZnF_C2H2 443 465 3.69e-4 SMART
ZnF_C2H2 471 493 5.14e-3 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 3.16e-3 SMART
ZnF_C2H2 555 577 3.16e-3 SMART
ZnF_C2H2 583 605 8.6e-5 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.43e-4 SMART
ZnF_C2H2 667 689 1.72e-4 SMART
ZnF_C2H2 695 717 9.73e-4 SMART
ZnF_C2H2 723 745 2.02e-1 SMART
ZnF_C2H2 751 773 1.69e-3 SMART
ZnF_C2H2 779 801 3.69e-4 SMART
ZnF_C2H2 807 829 7.37e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206757
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in 2610021A01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:2610021A01Rik APN 7 41625572 missense possibly damaging 0.61
IGL00566:2610021A01Rik APN 7 41625391 missense possibly damaging 0.53
R0940:2610021A01Rik UTSW 7 41626434 missense probably damaging 1.00
R1101:2610021A01Rik UTSW 7 41627359 missense probably damaging 1.00
R1180:2610021A01Rik UTSW 7 41625717 missense probably benign 0.41
R1560:2610021A01Rik UTSW 7 41626042 missense probably benign 0.09
R1740:2610021A01Rik UTSW 7 41626125 nonsense probably null
R1988:2610021A01Rik UTSW 7 41626657 nonsense probably null
R2041:2610021A01Rik UTSW 7 41625979 missense possibly damaging 0.63
R2964:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2966:2610021A01Rik UTSW 7 41626405 nonsense probably null
R4002:2610021A01Rik UTSW 7 41625540 missense possibly damaging 0.83
R4569:2610021A01Rik UTSW 7 41625838 missense probably benign 0.04
R4708:2610021A01Rik UTSW 7 41611885 missense probably damaging 1.00
R4880:2610021A01Rik UTSW 7 41627105 missense possibly damaging 0.47
R4933:2610021A01Rik UTSW 7 41626802 missense probably damaging 0.98
R5036:2610021A01Rik UTSW 7 41626154 missense possibly damaging 0.92
R5206:2610021A01Rik UTSW 7 41626585 nonsense probably null
R5235:2610021A01Rik UTSW 7 41624832 missense possibly damaging 0.53
R6449:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6488:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6904:2610021A01Rik UTSW 7 41626092 nonsense probably null
X0067:2610021A01Rik UTSW 7 41627317 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCTTCAACCTGGAGGAACG -3'
(R):5'- ATTTAAGAGTTGAGCCCTCGG -3'

Sequencing Primer
(F):5'- TCTCAGTTCTCAGGCTACAGAGAG -3'
(R):5'- GCAAAAGACCTGCCACATTCTTTAC -3'
Posted On2014-12-29