Incidental Mutation 'R2965:Col2a1'
ID256040
Institutional Source Beutler Lab
Gene Symbol Col2a1
Ensembl Gene ENSMUSG00000022483
Gene Namecollagen, type II, alpha 1
SynonymsM100856, Col2a, Col2a-1, Del1, Col2, Rgsc856, Lpk
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97975602-98004695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97976095 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1402 (I1402T)
Ref Sequence ENSEMBL: ENSMUSP00000085693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023123] [ENSMUST00000088355] [ENSMUST00000131560]
Predicted Effect unknown
Transcript: ENSMUST00000023123
AA Change: I1470T
SMART Domains Protein: ENSMUSP00000023123
Gene: ENSMUSG00000022483
AA Change: I1470T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
Pfam:Collagen 115 175 1.3e-11 PFAM
Pfam:Collagen 199 260 7.2e-11 PFAM
Pfam:Collagen 258 317 1.3e-12 PFAM
Pfam:Collagen 312 377 4e-9 PFAM
low complexity region 395 411 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
internal_repeat_5 456 468 5.45e-5 PROSPERO
low complexity region 471 513 N/A INTRINSIC
internal_repeat_3 516 619 3.99e-13 PROSPERO
internal_repeat_1 524 567 1.6e-17 PROSPERO
low complexity region 621 633 N/A INTRINSIC
low complexity region 636 655 N/A INTRINSIC
low complexity region 659 687 N/A INTRINSIC
low complexity region 696 753 N/A INTRINSIC
internal_repeat_5 756 768 5.45e-5 PROSPERO
low complexity region 783 804 N/A INTRINSIC
Pfam:Collagen 852 918 1.1e-8 PFAM
Pfam:Collagen 876 941 1.9e-9 PFAM
Pfam:Collagen 900 966 2.4e-9 PFAM
Pfam:Collagen 983 1049 2.1e-10 PFAM
low complexity region 1062 1081 N/A INTRINSIC
Pfam:Collagen 1101 1172 3.4e-9 PFAM
Pfam:Collagen 1158 1218 1.3e-9 PFAM
COLFI 1252 1487 3.06e-184 SMART
Predicted Effect unknown
Transcript: ENSMUST00000088355
AA Change: I1402T
SMART Domains Protein: ENSMUSP00000085693
Gene: ENSMUSG00000022483
AA Change: I1402T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Collagen 47 107 1.2e-11 PFAM
Pfam:Collagen 131 192 7.2e-11 PFAM
Pfam:Collagen 190 249 1.3e-12 PFAM
low complexity region 262 314 N/A INTRINSIC
Pfam:Collagen 327 405 3.5e-7 PFAM
Pfam:Collagen 361 429 7.6e-10 PFAM
internal_repeat_3 448 551 1.3e-13 PROSPERO
internal_repeat_7 454 466 2.86e-5 PROSPERO
internal_repeat_1 456 499 4.05e-18 PROSPERO
internal_repeat_6 481 504 1.7e-5 PROSPERO
low complexity region 553 565 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
low complexity region 591 619 N/A INTRINSIC
low complexity region 628 685 N/A INTRINSIC
internal_repeat_4 688 712 8.3e-12 PROSPERO
low complexity region 715 736 N/A INTRINSIC
low complexity region 747 784 N/A INTRINSIC
Pfam:Collagen 808 878 9.8e-9 PFAM
Pfam:Collagen 832 898 2.1e-9 PFAM
Pfam:Collagen 916 979 7.2e-10 PFAM
Pfam:Collagen 937 1005 2.1e-8 PFAM
Pfam:Collagen 973 1049 6e-7 PFAM
Pfam:Collagen 1030 1094 1.5e-10 PFAM
Pfam:Collagen 1088 1150 1.4e-9 PFAM
COLFI 1184 1419 3.06e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131560
SMART Domains Protein: ENSMUSP00000116951
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
low complexity region 109 132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type II collagen, the major component of cartilage and the vitreous humor of the eye. The encoded preproprotein forms homotrimeric, triple helical procollagen that undergoes proteolytic processing during fibirl formation. Mice harboring certain mutations in this gene exhibit severe chondrodysplasia characterized by short limbs and trunch, craniofacial deformities and cleft palate. A complete lack of the encoded protein in mice results in postnatal lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this locus affect cartilage development. Homozygotes die perinatally with anomalies such as shortened limbs without epiphiseal growth plates, cleft palate and persistence of notochord. Heterozygotes are dwarfed with reduced cartilage matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Ssrp1 A G 2: 85,041,586 T385A possibly damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Col2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Col2a1 APN 15 97976173 missense unknown
IGL01286:Col2a1 APN 15 97994878 missense unknown
IGL01369:Col2a1 APN 15 97977826 missense unknown
IGL01747:Col2a1 APN 15 97991392 splice site probably benign
IGL02086:Col2a1 APN 15 97986737 splice site probably null
IGL02549:Col2a1 APN 15 97977799 missense unknown
IGL03289:Col2a1 APN 15 97980881 missense unknown
IGL03369:Col2a1 APN 15 97982042 missense unknown
FR4304:Col2a1 UTSW 15 97988981 synonymous probably null
FR4340:Col2a1 UTSW 15 97988981 synonymous probably null
FR4342:Col2a1 UTSW 15 97988981 synonymous probably null
FR4589:Col2a1 UTSW 15 97988981 synonymous probably null
LCD18:Col2a1 UTSW 15 97988981 synonymous probably null
R0124:Col2a1 UTSW 15 97998862 missense unknown
R0227:Col2a1 UTSW 15 97976755 missense unknown
R0690:Col2a1 UTSW 15 97980192 missense unknown
R1434:Col2a1 UTSW 15 97979651 missense probably damaging 0.96
R1473:Col2a1 UTSW 15 97982908 splice site probably benign
R1577:Col2a1 UTSW 15 97979202 missense probably damaging 1.00
R1598:Col2a1 UTSW 15 97979250 missense probably damaging 0.99
R1837:Col2a1 UTSW 15 97996641 splice site probably benign
R2153:Col2a1 UTSW 15 97987580 missense unknown
R2966:Col2a1 UTSW 15 97976095 missense unknown
R3710:Col2a1 UTSW 15 97990907 splice site probably benign
R3838:Col2a1 UTSW 15 97988976 missense unknown
R3838:Col2a1 UTSW 15 98000581 intron probably benign
R4112:Col2a1 UTSW 15 97983701 missense probably benign 0.18
R4417:Col2a1 UTSW 15 97998585 missense unknown
R4656:Col2a1 UTSW 15 97976176 missense unknown
R4960:Col2a1 UTSW 15 97976149 missense unknown
R5008:Col2a1 UTSW 15 97979669 missense probably benign 0.28
R5435:Col2a1 UTSW 15 98000510 intron probably benign
R5473:Col2a1 UTSW 15 97987489 missense unknown
R6042:Col2a1 UTSW 15 98000570 intron probably benign
R6118:Col2a1 UTSW 15 97998567 missense unknown
R6183:Col2a1 UTSW 15 97988790 missense unknown
R6187:Col2a1 UTSW 15 97988790 missense unknown
R6401:Col2a1 UTSW 15 97985892 missense unknown
R6550:Col2a1 UTSW 15 97976793 missense unknown
R6568:Col2a1 UTSW 15 97977276 missense unknown
R6988:Col2a1 UTSW 15 98004454 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTCTTAGAAAGGGGAGCAC -3'
(R):5'- AGTGTCGTCCCTACCTTGTG -3'

Sequencing Primer
(F):5'- CTCTTAGAAAGGGGAGCACAGTCC -3'
(R):5'- CCTACCTTGTGGCTGCTTAG -3'
Posted On2014-12-29