Incidental Mutation 'R2938:Postn'
ID256085
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54370310 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 242 (F242Y)
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect probably damaging
Transcript: ENSMUST00000073012
AA Change: F242Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: F242Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081564
AA Change: F242Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: F242Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107985
AA Change: F242Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: F242Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117373
AA Change: F242Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: F242Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense probably damaging 1.00
R0117:Postn UTSW 3 54383481 splice site probably benign
R0270:Postn UTSW 3 54384550 missense probably damaging 0.98
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1648:Postn UTSW 3 54376101 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1823:Postn UTSW 3 54385287 critical splice donor site probably null
R1938:Postn UTSW 3 54377612 splice site probably null
R2311:Postn UTSW 3 54385223 missense probably damaging 0.98
R2566:Postn UTSW 3 54376953 missense probably damaging 0.97
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4394:Postn UTSW 3 54370955 missense probably damaging 1.00
R4620:Postn UTSW 3 54376993 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
R7131:Postn UTSW 3 54362635 missense probably damaging 1.00
R7322:Postn UTSW 3 54370280 missense probably damaging 1.00
R7430:Postn UTSW 3 54370202 missense probably damaging 1.00
R7497:Postn UTSW 3 54362670 missense probably damaging 1.00
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GAAATCGCCTTCCTGTCTTAGC -3'
(R):5'- GTAGCCACACAAAGAGCCTTTC -3'

Sequencing Primer
(F):5'- CCTGTCTTAGCAGTCAATGACTAG -3'
(R):5'- ACTATTACTATATGTGGGATGGTCTC -3'
Posted On2014-12-29