Incidental Mutation 'R2938:Gimap8'
ID256105
Institutional Source Beutler Lab
Gene Symbol Gimap8
Ensembl Gene ENSMUSG00000064262
Gene NameGTPase, IMAP family member 8
SynonymsIAN9, LOC243374
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48647234-48660875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48658796 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 498 (R498S)
Ref Sequence ENSEMBL: ENSMUSP00000145255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078223] [ENSMUST00000203083] [ENSMUST00000203509]
Predicted Effect unknown
Transcript: ENSMUST00000078223
AA Change: I336F
SMART Domains Protein: ENSMUSP00000077350
Gene: ENSMUSG00000064262
AA Change: I336F

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203083
AA Change: R498S

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145286
Gene: ENSMUSG00000064262
AA Change: R498S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203509
AA Change: R498S

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145255
Gene: ENSMUSG00000064262
AA Change: R498S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The encoded protein is larger than the other gene family members and includes three AIG1 domains (corresponding to the AIG1 protein from Arabidopsis thaliana) whereas other family members have one AIG1 domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Gimap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gimap8 APN 6 48658767 missense probably damaging 1.00
IGL02830:Gimap8 APN 6 48656305 missense probably benign 0.01
Kangchenjunga UTSW 6 48659163 missense probably damaging 1.00
lhotse UTSW 6 48658954 missense possibly damaging 0.74
R1224:Gimap8 UTSW 6 48650695 missense probably benign 0.04
R1386:Gimap8 UTSW 6 48656653 missense probably benign 0.04
R1503:Gimap8 UTSW 6 48647529 critical splice donor site probably null
R1560:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R1681:Gimap8 UTSW 6 48656411 missense probably benign 0.01
R2012:Gimap8 UTSW 6 48656353 missense probably damaging 0.98
R2094:Gimap8 UTSW 6 48650568 missense probably benign 0.00
R2937:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R3147:Gimap8 UTSW 6 48650506 missense probably damaging 1.00
R4276:Gimap8 UTSW 6 48659083 missense probably benign 0.35
R4281:Gimap8 UTSW 6 48658820 missense probably benign 0.37
R4294:Gimap8 UTSW 6 48658957 missense probably benign 0.00
R4713:Gimap8 UTSW 6 48658986 missense probably benign 0.23
R4750:Gimap8 UTSW 6 48650427 missense probably benign 0.01
R4896:Gimap8 UTSW 6 48659347 missense possibly damaging 0.85
R4936:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R5041:Gimap8 UTSW 6 48659163 missense probably damaging 1.00
R5091:Gimap8 UTSW 6 48656647 missense possibly damaging 0.91
R5215:Gimap8 UTSW 6 48651083 missense possibly damaging 0.88
R5360:Gimap8 UTSW 6 48656302 missense probably damaging 1.00
R6119:Gimap8 UTSW 6 48658954 missense possibly damaging 0.74
R6221:Gimap8 UTSW 6 48658942 missense probably damaging 1.00
R6450:Gimap8 UTSW 6 48656451 missense probably benign 0.03
R7137:Gimap8 UTSW 6 48650253 missense probably damaging 0.99
R7154:Gimap8 UTSW 6 48656188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCAGTCTCATGTGTGGG -3'
(R):5'- CTTCTTCGCAGAGACTCAAACAG -3'

Sequencing Primer
(F):5'- ACAGACCTGCTCAGTGATGTCTG -3'
(R):5'- TCAAACAGTGATGGATCTCCTC -3'
Posted On2014-12-29