Incidental Mutation 'R2938:Eml6'
ID256118
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 29833049 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAGCTCCAGAACAGATACTAGGAG -3'
(R):5'- GCCAAATTTAGAAAGTATGTGGGC -3'

Sequencing Primer
(F):5'- CTTCTGGGTGTCTGAAAACAGCTAC -3'
(R):5'- AAAGTATGTGGGCCACTCTGC -3'
Posted On2014-12-29