Incidental Mutation 'R1611:Zfp341'
ID256134
Institutional Source Beutler Lab
Gene Symbol Zfp341
Ensembl Gene ENSMUSG00000059842
Gene Namezinc finger protein 341
Synonyms
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1611 (G1)
Quality Score60
Status Validated
Chromosome2
Chromosomal Location154613297-154646821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154645703 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 702 (H702Q)
Ref Sequence ENSEMBL: ENSMUSP00000080596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081926] [ENSMUST00000109702] [ENSMUST00000126421]
Predicted Effect probably damaging
Transcript: ENSMUST00000081926
AA Change: H702Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080596
Gene: ENSMUSG00000059842
AA Change: H702Q

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 320 342 3.69e-4 SMART
ZnF_C2H2 348 370 1.04e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 470 494 2.17e-1 SMART
ZnF_C2H2 500 522 2.91e-2 SMART
ZnF_C2H2 537 561 1.23e0 SMART
ZnF_C2H2 563 585 3.58e-2 SMART
ZnF_C2H2 591 613 1.62e0 SMART
ZnF_C2H2 619 641 2.27e-4 SMART
ZnF_C2H2 647 674 7.29e0 SMART
ZnF_C2H2 680 702 5.14e-3 SMART
low complexity region 740 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109702
AA Change: H695Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105324
Gene: ENSMUSG00000059842
AA Change: H695Q

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 313 335 3.69e-4 SMART
ZnF_C2H2 341 363 1.04e-3 SMART
ZnF_C2H2 435 457 1.45e-2 SMART
ZnF_C2H2 463 487 2.17e-1 SMART
ZnF_C2H2 493 515 2.91e-2 SMART
ZnF_C2H2 530 554 1.23e0 SMART
ZnF_C2H2 556 578 3.58e-2 SMART
ZnF_C2H2 584 606 1.62e0 SMART
ZnF_C2H2 612 634 2.27e-4 SMART
ZnF_C2H2 640 667 7.29e0 SMART
ZnF_C2H2 673 695 5.14e-3 SMART
low complexity region 733 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126421
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Other mutations in Zfp341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp341 APN 2 154634231 missense probably damaging 1.00
IGL01352:Zfp341 APN 2 154628896 missense probably benign 0.00
IGL01748:Zfp341 APN 2 154628927 missense probably damaging 0.99
IGL02260:Zfp341 APN 2 154642049 missense possibly damaging 0.89
IGL02329:Zfp341 APN 2 154632304 missense possibly damaging 0.90
casanova_grimbacher UTSW 2 154624881 missense probably damaging 1.00
specious UTSW 2 154646134 missense possibly damaging 0.63
R0079:Zfp341 UTSW 2 154624994 nonsense probably null
R0570:Zfp341 UTSW 2 154646068 missense probably benign 0.02
R0620:Zfp341 UTSW 2 154634273 missense possibly damaging 0.94
R1018:Zfp341 UTSW 2 154646052 missense probably damaging 1.00
R1733:Zfp341 UTSW 2 154641378 missense probably benign 0.19
R1822:Zfp341 UTSW 2 154646134 missense possibly damaging 0.63
R1956:Zfp341 UTSW 2 154638212 missense probably benign 0.09
R2437:Zfp341 UTSW 2 154628801 missense probably damaging 0.97
R3623:Zfp341 UTSW 2 154624881 missense probably damaging 1.00
R4417:Zfp341 UTSW 2 154628987 missense possibly damaging 0.94
R4806:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4807:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4863:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4955:Zfp341 UTSW 2 154638030 missense probably damaging 0.98
R4962:Zfp341 UTSW 2 154626814 missense possibly damaging 0.80
R5484:Zfp341 UTSW 2 154625001 missense probably benign 0.00
R5864:Zfp341 UTSW 2 154643554 missense possibly damaging 0.95
R5877:Zfp341 UTSW 2 154632289 missense probably damaging 1.00
R5975:Zfp341 UTSW 2 154630441 missense probably damaging 1.00
R5990:Zfp341 UTSW 2 154645659 missense probably damaging 0.98
R6057:Zfp341 UTSW 2 154625034 missense probably benign 0.01
R6882:Zfp341 UTSW 2 154638023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGCAGATGACTTCAGGCACGG -3'
(R):5'- AACACAGCGTCCTGCTCAAAGG -3'

Sequencing Primer
(F):5'- CTTCAGGCACGGGAACAG -3'
(R):5'- TCAAAGGGTGGCTTGCCAG -3'
Posted On2014-12-30