Incidental Mutation 'R1636:Unc13a'
ID256139
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 039672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1636 (G1)
Quality Score61
Status Validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71653390 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 690 (T690I)
Ref Sequence ENSEMBL: ENSMUSP00000135189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect probably damaging
Transcript: ENSMUST00000030170
AA Change: T690I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: T690I

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176426
Predicted Effect probably damaging
Transcript: ENSMUST00000177517
AA Change: T690I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: T690I

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Abca7 A G 10: 80,008,998 H1518R probably benign Het
Adam4 A G 12: 81,419,690 L719S probably damaging Het
Adprm T C 11: 67,041,723 Y120C possibly damaging Het
Arhgap25 T A 6: 87,495,941 Y78F probably damaging Het
Asap1 G A 15: 64,123,912 P665L probably damaging Het
Bank1 T C 3: 136,083,226 K637R probably damaging Het
BC005561 T A 5: 104,520,750 M1046K probably damaging Het
Bcr T A 10: 75,131,066 L502M probably damaging Het
Brwd1 A G 16: 96,059,641 L315P probably damaging Het
Btbd7 A T 12: 102,793,851 Y613N probably damaging Het
Cdca7l G A 12: 117,876,928 R395H probably damaging Het
Cftr T A 6: 18,226,157 I368K probably damaging Het
D6Wsu163e T C 6: 126,946,601 V150A possibly damaging Het
Ddx52 A G 11: 83,955,343 T470A probably damaging Het
Def6 A G 17: 28,223,918 E316G possibly damaging Het
Dip2a A T 10: 76,321,578 N64K probably benign Het
Dlgap4 G T 2: 156,746,077 E631* probably null Het
Dner T C 1: 84,585,330 K190E possibly damaging Het
Eif2b4 T A 5: 31,192,266 probably null Het
Eif3a A T 19: 60,781,905 D119E possibly damaging Het
Ercc2 C T 7: 19,387,124 T276M possibly damaging Het
Exoc1 A G 5: 76,568,118 K830R probably benign Het
F2r G T 13: 95,603,892 Y378* probably null Het
Fam186a G A 15: 99,941,658 T2235I unknown Het
Fmo3 T G 1: 162,954,425 K453T probably benign Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Galns A G 8: 122,604,216 probably benign Het
Gm1818 T C 12: 48,555,767 noncoding transcript Het
Gm9955 C A 18: 24,709,230 probably benign Het
Immp2l T C 12: 41,703,687 V113A probably damaging Het
Iyd T A 10: 3,545,588 M82K possibly damaging Het
Kif21a A T 15: 90,984,805 probably benign Het
Lipf A G 19: 33,976,535 D342G probably damaging Het
Lmbrd1 C A 1: 24,746,930 Y435* probably null Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mtrf1l A G 10: 5,813,265 S355P probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neo1 T C 9: 58,913,277 S788G probably damaging Het
Nfx1 T G 4: 41,016,072 probably null Het
Nlrp4c T C 7: 6,066,738 V546A possibly damaging Het
Nwd2 G A 5: 63,807,557 V1495M probably damaging Het
Oaf T A 9: 43,239,324 I84F probably benign Het
Obscn A G 11: 59,122,637 F1153S probably damaging Het
Ofcc1 A T 13: 40,180,428 C396S possibly damaging Het
Olfr576 T G 7: 102,965,691 I197S possibly damaging Het
Olfr955 T C 9: 39,469,919 D269G probably benign Het
Omg A G 11: 79,502,340 S231P probably benign Het
Pdcl3 A G 1: 38,994,935 T53A possibly damaging Het
Pik3r2 A T 8: 70,771,898 H244Q probably benign Het
Pinx1 A T 14: 63,866,137 H55L probably damaging Het
Pwwp2b T A 7: 139,254,842 H66Q probably benign Het
Rell2 A G 18: 37,958,079 D99G probably damaging Het
Reln G A 5: 21,998,683 A1191V probably damaging Het
Rprm T C 2: 54,085,304 M1V probably null Het
Sav1 A C 12: 69,984,495 H84Q probably benign Het
Scamp5 T C 9: 57,451,409 D28G possibly damaging Het
Selenbp2 G A 3: 94,696,815 G9D probably damaging Het
Sh3tc2 T C 18: 61,989,721 W518R probably damaging Het
Slc10a6 A T 5: 103,629,146 N29K probably benign Het
Spindoc C A 19: 7,374,557 D142Y probably damaging Het
Spink12 T A 18: 44,107,728 D60E probably benign Het
Sugt1 A G 14: 79,587,982 I23V probably benign Het
Syne2 T C 12: 76,004,732 C4079R probably benign Het
Tex15 T G 8: 33,576,387 Y1948* probably null Het
Tln2 T C 9: 67,306,532 E321G probably damaging Het
Tmem198b A G 10: 128,802,196 L166P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttn T A 2: 76,900,222 probably benign Het
Ush2a T C 1: 188,466,176 I1479T possibly damaging Het
Vcan G A 13: 89,703,667 T1058I possibly damaging Het
Vmn1r84 T C 7: 12,362,595 Q45R probably benign Het
Vmn2r111 T C 17: 22,571,399 N209D probably damaging Het
Wbp1l A G 19: 46,644,444 Y40C probably damaging Het
Wdr72 A T 9: 74,179,625 H625L probably benign Het
Zeb2 T C 2: 45,002,611 Y195C probably damaging Het
Zkscan6 C T 11: 65,814,430 probably benign Het
Zmym6 C A 4: 127,123,767 H1022N probably damaging Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense not run
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTAGTCTTGCTAGAGAGTTGCCAC -3'
(R):5'- TGCTGAAGGACCGCATGAAGATCC -3'

Sequencing Primer
(F):5'- ttcactcaccactcttccac -3'
(R):5'- CGCATGAAGATCCGCGAG -3'
Posted On2014-12-30