Incidental Mutation 'R0325:Crb1'
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
MMRRC Submission 038535-MU
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R0325 (G1)
Quality Score225
Status Not validated
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 139241166 bp
Amino Acid Change Cysteine to Tryptophan at position 871 (C871W)
Ref Sequence ENSEMBL: ENSMUSP00000142552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000198445]
Predicted Effect probably damaging
Transcript: ENSMUST00000059825
AA Change: C932W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: C932W

low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198445
AA Change: C871W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681
AA Change: C871W

low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 333 1.63e1 SMART
EGF_CA 335 377 2.54e-7 SMART
EGF 382 419 1.47e-3 SMART
LamG 444 589 1.75e-9 SMART
EGF 613 646 6.5e-5 SMART
LamG 673 798 1.05e-7 SMART
EGF 828 861 1.19e-3 SMART
LamG 910 1043 6.85e-12 SMART
EGF 1080 1113 7.07e-6 SMART
EGF_CA 1115 1150 3.01e-9 SMART
EGF 1155 1188 3.57e-2 SMART
EGF 1196 1233 6.92e0 SMART
EGF_CA 1235 1271 4.19e-8 SMART
low complexity region 1282 1296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199291
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Atp7b G A 8: 22,028,451 L124F probably benign Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fmn2 T A 1: 174,609,954 probably null Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Galnt6 A T 15: 100,693,471 probably null Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lama3 A C 18: 12,482,126 D1369A probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Papola T A 12: 105,807,193 I157N probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc4a2 A T 5: 24,435,943 I747F probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Spata16 A G 3: 26,667,456 E42G probably damaging Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Unc80 G T 1: 66,510,881 G766V probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02984:Crb1 UTSW 1 139237086 frame shift probably null
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0401:Crb1 UTSW 1 139198791 splice site probably benign
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R0734:Crb1 UTSW 1 139337084 missense probably benign 0.25
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2057:Crb1 UTSW 1 139314750 missense probably damaging 1.00
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R5968:Crb1 UTSW 1 139243001 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tctcctttcttcttttcttctgttc -3'
Posted On2013-04-16