Incidental Mutation 'R1671:C130026I21Rik'
Institutional Source Beutler Lab
Gene Symbol C130026I21Rik
Ensembl Gene ENSMUSG00000052477
Gene NameRIKEN cDNA C130026I21 gene
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R1671 (G1)
Quality Score49
Status Validated
Chromosomal Location84992690-85270566 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 85257385 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064341] [ENSMUST00000093506] [ENSMUST00000159582] [ENSMUST00000161267] [ENSMUST00000162421]
Predicted Effect probably benign
Transcript: ENSMUST00000064341
SMART Domains Protein: ENSMUSP00000066587
Gene: ENSMUSG00000052477

Pfam:Sp100 23 125 2.8e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093506
SMART Domains Protein: ENSMUSP00000091224
Gene: ENSMUSG00000052477

Pfam:Sp100 24 122 1.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159582
SMART Domains Protein: ENSMUSP00000125160
Gene: ENSMUSG00000052477

Pfam:Sp100 23 125 6.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161267
SMART Domains Protein: ENSMUSP00000124435
Gene: ENSMUSG00000052477

Pfam:Sp100 23 119 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162347
Predicted Effect probably benign
Transcript: ENSMUST00000162421
SMART Domains Protein: ENSMUSP00000125215
Gene: ENSMUSG00000052477

Pfam:Sp100 40 135 2.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166777
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in C130026I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:C130026I21Rik APN 1 85254186 intron probably benign
IGL01876:C130026I21Rik APN 1 85254186 intron probably benign
IGL01880:C130026I21Rik APN 1 85254186 intron probably benign
IGL01883:C130026I21Rik APN 1 85254186 intron probably benign
IGL01886:C130026I21Rik APN 1 85254186 intron probably benign
IGL01888:C130026I21Rik APN 1 85254186 intron probably benign
IGL01893:C130026I21Rik APN 1 85254186 intron probably benign
IGL01898:C130026I21Rik APN 1 85254186 intron probably benign
IGL01906:C130026I21Rik APN 1 85254186 intron probably benign
IGL01908:C130026I21Rik APN 1 85254186 intron probably benign
IGL01909:C130026I21Rik APN 1 85254186 intron probably benign
IGL01916:C130026I21Rik APN 1 85254186 intron probably benign
IGL01918:C130026I21Rik APN 1 85254186 intron probably benign
IGL01920:C130026I21Rik APN 1 85254186 intron probably benign
IGL01923:C130026I21Rik APN 1 85254186 intron probably benign
IGL01928:C130026I21Rik APN 1 85254186 intron probably benign
IGL01933:C130026I21Rik APN 1 85254186 intron probably benign
IGL01945:C130026I21Rik APN 1 85254186 intron probably benign
IGL01949:C130026I21Rik APN 1 85254186 intron probably benign
IGL01951:C130026I21Rik APN 1 85254186 intron probably benign
IGL01952:C130026I21Rik APN 1 85254186 intron probably benign
PIT4131001:C130026I21Rik UTSW 1 85245674 intron probably benign
PIT4142001:C130026I21Rik UTSW 1 85245674 intron probably benign
R0067:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R0367:C130026I21Rik UTSW 1 85270103 start gained probably benign
R0389:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R1284:C130026I21Rik UTSW 1 85270055 missense probably damaging 0.98
R1620:C130026I21Rik UTSW 1 85254186 intron probably benign
R1622:C130026I21Rik UTSW 1 85254186 intron probably benign
R3115:C130026I21Rik UTSW 1 85257385 intron probably benign
R4120:C130026I21Rik UTSW 1 85259821 missense possibly damaging 0.82
R4223:C130026I21Rik UTSW 1 85112557 missense probably damaging 0.98
R4947:C130026I21Rik UTSW 1 85112482 missense probably damaging 1.00
R4996:C130026I21Rik UTSW 1 85247094 missense probably benign 0.12
R5152:C130026I21Rik UTSW 1 85261860 missense probably benign 0.04
R6614:C130026I21Rik UTSW 1 85202060 intron probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gtgggtgagtaagtggatgg -3'
Posted On2015-01-05