Incidental Mutation 'R1597:Olfr68'
ID257007
Institutional Source Beutler Lab
Gene Symbol Olfr68
Ensembl Gene ENSMUSG00000061626
Gene Nameolfactory receptor 68
Synonyms3'[b]2, MOR22-3, GA_x6K02T2PBJ9-6504436-6503489
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1597 (G1)
Quality Score61
Status Validated
Chromosome7
Chromosomal Location103774358-103779698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103778060 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 95 (F95S)
Ref Sequence ENSEMBL: ENSMUSP00000150493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072513] [ENSMUST00000216811]
Predicted Effect probably benign
Transcript: ENSMUST00000072513
AA Change: F95S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072329
Gene: ENSMUSG00000061626
AA Change: F95S

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 3e-101 PFAM
Pfam:7TM_GPCR_Srx 34 237 4.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 37 264 1.7e-6 PFAM
Pfam:7tm_1 43 295 2.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216811
AA Change: F95S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Olfr68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Olfr68 APN 7 103778241 missense probably benign
IGL03310:Olfr68 APN 7 103777427 missense probably benign 0.04
R0135:Olfr68 UTSW 7 103777763 missense probably damaging 0.99
R0462:Olfr68 UTSW 7 103777563 missense probably benign 0.37
R0966:Olfr68 UTSW 7 103777449 missense probably damaging 1.00
R1199:Olfr68 UTSW 7 103777985 missense probably damaging 1.00
R1288:Olfr68 UTSW 7 103778042 missense possibly damaging 0.94
R4631:Olfr68 UTSW 7 103777475 missense probably damaging 1.00
R4754:Olfr68 UTSW 7 103777668 missense probably benign 0.00
R5184:Olfr68 UTSW 7 103777404 missense probably benign 0.00
R5654:Olfr68 UTSW 7 103777975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTAATGCACCAGCTCCAAGG -3'
(R):5'- GTTGAAGCAGCAATACTGCTACACG -3'

Sequencing Primer
(F):5'- GCTCCAAGGCAAGTGGTG -3'
(R):5'- GCAATACTGCTACACGTTTCTGAG -3'
Posted On2015-01-07