Incidental Mutation 'R2980:Ctdnep1'
ID257059
Institutional Source Beutler Lab
Gene Symbol Ctdnep1
Ensembl Gene ENSMUSG00000018559
Gene NameCTD nuclear envelope phosphatase 1
Synonyms2610507E10Rik, Dullard
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2980 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69981156-69990601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69988671 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 7 (A7D)
Ref Sequence ENSEMBL: ENSMUSP00000137199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018711] [ENSMUST00000108592] [ENSMUST00000108593] [ENSMUST00000141623]
Predicted Effect probably benign
Transcript: ENSMUST00000018711
SMART Domains Protein: ENSMUSP00000018711
Gene: ENSMUSG00000018567

DomainStartEndE-ValueType
Pfam:Atg8 13 116 1.8e-51 PFAM
Pfam:APG12 30 116 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108592
SMART Domains Protein: ENSMUSP00000104233
Gene: ENSMUSG00000018567

DomainStartEndE-ValueType
Pfam:Atg8 13 93 5.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108593
AA Change: A140D

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104234
Gene: ENSMUSG00000018559
AA Change: A140D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
CPDc 60 212 7.35e-76 SMART
low complexity region 214 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139007
Predicted Effect probably damaging
Transcript: ENSMUST00000141623
AA Change: A7D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137199
Gene: ENSMUSG00000018559
AA Change: A7D

DomainStartEndE-ValueType
CPDc 1 79 6.29e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152226
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, abnormal extraembryonic tissue development, poorly developed head fold and trunk and severely reduced primordial germ cell numbers due to a failure to transit to mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,687,308 I236T probably benign Het
Alms1 T C 6: 85,628,835 L2489P probably damaging Het
Astn1 G T 1: 158,572,951 probably null Het
BC051665 T C 13: 60,784,395 T127A probably damaging Het
Blnk T C 19: 40,962,350 Y119C probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Ddx4 A T 13: 112,612,085 D452E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Jak1 T C 4: 101,179,781 I221V probably damaging Het
Kremen1 G GGGT 11: 5,201,794 probably benign Het
Sox21 T C 14: 118,235,550 E29G probably damaging Het
Tox4 T C 14: 52,292,526 S548P probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfy1 T C Y: 739,054 N51D unknown Het
Other mutations in Ctdnep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03246:Ctdnep1 APN 11 69984330 unclassified probably benign
R0118:Ctdnep1 UTSW 11 69988731 critical splice donor site probably null
R1521:Ctdnep1 UTSW 11 69988635 missense probably damaging 1.00
R3932:Ctdnep1 UTSW 11 69989574 unclassified probably benign
R4117:Ctdnep1 UTSW 11 69988671 missense probably damaging 0.97
R5383:Ctdnep1 UTSW 11 69984396 unclassified probably benign
R5485:Ctdnep1 UTSW 11 69981490 missense possibly damaging 0.93
R5913:Ctdnep1 UTSW 11 69988865 missense probably damaging 1.00
R6214:Ctdnep1 UTSW 11 69989508 missense probably damaging 1.00
R6706:Ctdnep1 UTSW 11 69984312 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAGTCTCAAGGGCCTTC -3'
(R):5'- CAAAGTGCAGTGCTGGAAAC -3'

Sequencing Primer
(F):5'- TTCCCCAGACACTGAGCG -3'
(R):5'- CAGAGGACTATGGAGCACACC -3'
Posted On2015-01-11