Incidental Mutation 'R0325:Slc4a2'
ID25706
Institutional Source Beutler Lab
Gene Symbol Slc4a2
Ensembl Gene ENSMUSG00000028962
Gene Namesolute carrier family 4 (anion exchanger), member 2
SynonymsB3RP, Ae2
MMRRC Submission 038535-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.575) question?
Stock #R0325 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24423837-24440950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24435943 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 747 (I747F)
Ref Sequence ENSEMBL: ENSMUSP00000110699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080067] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049]
Predicted Effect probably damaging
Transcript: ENSMUST00000080067
AA Change: I761F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962
AA Change: I761F

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115043
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115047
AA Change: I747F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962
AA Change: I747F

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115049
AA Change: I752F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962
AA Change: I752F

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198786
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice carrying an isoform-specific allele display male infertility associated with disrupted spermiogenesis and germ cell apoptosis. Mice homozygous for a null allele display perinatal and postnatal lethality, loss of gastric acid secretion, failure of tooth eruption, aphagia, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Atp7b G A 8: 22,028,451 L124F probably benign Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
Crb1 A C 1: 139,241,166 C871W probably damaging Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fmn2 T A 1: 174,609,954 probably null Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Galnt6 A T 15: 100,693,471 probably null Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lama3 A C 18: 12,482,126 D1369A probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Papola T A 12: 105,807,193 I157N probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Spata16 A G 3: 26,667,456 E42G probably damaging Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Unc80 G T 1: 66,510,881 G766V probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Slc4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Slc4a2 APN 5 24439068 missense probably damaging 1.00
IGL00772:Slc4a2 APN 5 24435196 missense probably damaging 1.00
IGL00897:Slc4a2 APN 5 24429559 nonsense probably null
IGL01477:Slc4a2 APN 5 24430156 unclassified probably benign
IGL01680:Slc4a2 APN 5 24432930 missense probably benign 0.23
IGL01681:Slc4a2 APN 5 24434187 missense probably damaging 1.00
IGL01808:Slc4a2 APN 5 24440207 missense probably damaging 1.00
IGL02399:Slc4a2 APN 5 24434713 missense probably damaging 1.00
IGL02501:Slc4a2 APN 5 24429434 missense probably benign 0.00
IGL03214:Slc4a2 APN 5 24434881 missense probably benign 0.01
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0309:Slc4a2 UTSW 5 24434346 missense probably damaging 1.00
R0656:Slc4a2 UTSW 5 24431259 missense probably benign 0.05
R0755:Slc4a2 UTSW 5 24435577 missense probably benign 0.07
R0946:Slc4a2 UTSW 5 24435886 missense probably damaging 1.00
R1075:Slc4a2 UTSW 5 24439057 missense possibly damaging 0.85
R1733:Slc4a2 UTSW 5 24429567 missense probably damaging 1.00
R1794:Slc4a2 UTSW 5 24439328 missense probably damaging 1.00
R1823:Slc4a2 UTSW 5 24427620 missense probably damaging 0.99
R2048:Slc4a2 UTSW 5 24431559 missense probably damaging 1.00
R2165:Slc4a2 UTSW 5 24431316 missense probably damaging 1.00
R2181:Slc4a2 UTSW 5 24435653 missense possibly damaging 0.80
R2405:Slc4a2 UTSW 5 24435601 missense probably damaging 1.00
R3551:Slc4a2 UTSW 5 24430101 missense probably benign 0.01
R4423:Slc4a2 UTSW 5 24439848 nonsense probably null
R4457:Slc4a2 UTSW 5 24434330 unclassified probably benign
R4678:Slc4a2 UTSW 5 24434240 critical splice donor site probably null
R4730:Slc4a2 UTSW 5 24434880 missense probably damaging 1.00
R4824:Slc4a2 UTSW 5 24440143 missense probably damaging 1.00
R4928:Slc4a2 UTSW 5 24435342 critical splice donor site probably null
R4993:Slc4a2 UTSW 5 24434869 missense probably damaging 1.00
R5071:Slc4a2 UTSW 5 24438762 missense probably benign
R5072:Slc4a2 UTSW 5 24438762 missense probably benign
R5073:Slc4a2 UTSW 5 24438762 missense probably benign
R5074:Slc4a2 UTSW 5 24438762 missense probably benign
R5108:Slc4a2 UTSW 5 24439333 missense probably damaging 1.00
R5135:Slc4a2 UTSW 5 24430127 missense possibly damaging 0.78
R5349:Slc4a2 UTSW 5 24435635 missense possibly damaging 0.74
R5601:Slc4a2 UTSW 5 24438774 missense probably benign 0.07
R5666:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R5670:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R6256:Slc4a2 UTSW 5 24435890 missense probably damaging 1.00
R6861:Slc4a2 UTSW 5 24435009 missense probably damaging 1.00
X0027:Slc4a2 UTSW 5 24435914 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGACTTCCGCGATGCACTTGAC -3'
(R):5'- CCTGGGTGAATCGGGATACAAAGC -3'

Sequencing Primer
(F):5'- GATGCACTTGACCCCCAG -3'
(R):5'- TCGGGATACAAAGCGGACC -3'
Posted On2013-04-16