Incidental Mutation 'R2982:Olfr364-ps1'
ID257092
Institutional Source Beutler Lab
Gene Symbol Olfr364-ps1
Ensembl Gene ENSMUSG00000078198
Gene Nameolfactory receptor 364, pseudogene 1
SynonymsGA_x6K02T2NLDC-33831282-33832243, MOR138-4P, MOR138-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2982 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37139322-37148585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37146381 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 56 (M56I)
Ref Sequence ENSEMBL: ENSMUSP00000151166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104995] [ENSMUST00000214905] [ENSMUST00000217298]
Predicted Effect probably damaging
Transcript: ENSMUST00000104995
AA Change: M56I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100611
Gene: ENSMUSG00000078198
AA Change: M56I

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 4.8e-58 PFAM
Pfam:7tm_1 38 287 5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214905
AA Change: M56I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217298
AA Change: M56I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr1 T C 8: 25,558,211 F106L probably benign Het
Hpse2 T A 19: 43,384,743 D149V probably null Het
Hsd3b5 T A 3: 98,619,800 D110V possibly damaging Het
Klhl42 T C 6: 147,091,616 Y29H probably damaging Het
Klk1 G A 7: 44,229,439 C117Y probably damaging Het
Mfhas1 T C 8: 35,591,115 Y915H probably benign Het
Msantd2 A G 9: 37,523,343 Q293R probably damaging Het
Olfr1016 T A 2: 85,799,350 I307F probably benign Het
Olfr1352 T C 10: 78,984,440 S217P probably damaging Het
Osgin1 T G 8: 119,442,535 L35R probably damaging Het
Rufy1 C T 11: 50,419,708 R210K possibly damaging Het
Spats2 T C 15: 99,211,046 S426P probably benign Het
Tnc T A 4: 64,020,519 I28F possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp512 C A 5: 31,476,778 probably null Het
Other mutations in Olfr364-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr364-ps1 APN 2 37147067 missense probably damaging 1.00
IGL01550:Olfr364-ps1 APN 2 37146974 missense probably damaging 1.00
IGL01791:Olfr364-ps1 APN 2 37146536 missense probably damaging 1.00
IGL01886:Olfr364-ps1 APN 2 37146509 missense probably damaging 1.00
IGL02680:Olfr364-ps1 APN 2 37146415 missense probably damaging 1.00
IGL03003:Olfr364-ps1 APN 2 37146452 missense probably benign 0.00
IGL03289:Olfr364-ps1 APN 2 37146578 missense probably damaging 1.00
R0627:Olfr364-ps1 UTSW 2 37146330 missense probably damaging 0.96
R1163:Olfr364-ps1 UTSW 2 37147027 missense probably damaging 1.00
R1253:Olfr364-ps1 UTSW 2 37146872 missense possibly damaging 0.89
R1340:Olfr364-ps1 UTSW 2 37146757 missense probably benign 0.03
R1542:Olfr364-ps1 UTSW 2 37146966 missense probably damaging 1.00
R1633:Olfr364-ps1 UTSW 2 37146971 missense probably damaging 0.99
R2935:Olfr364-ps1 UTSW 2 37147111 missense possibly damaging 0.75
R3855:Olfr364-ps1 UTSW 2 37146823 missense possibly damaging 0.95
R4849:Olfr364-ps1 UTSW 2 37146254 missense probably damaging 0.97
R4903:Olfr364-ps1 UTSW 2 37146371 missense probably benign 0.35
R5160:Olfr364-ps1 UTSW 2 37146803 missense probably benign 0.03
R7092:Olfr364-ps1 UTSW 2 37146611 missense probably damaging 1.00
R7108:Olfr364-ps1 UTSW 2 37146260 missense probably benign 0.00
R7143:Olfr364-ps1 UTSW 2 37146874 missense probably benign 0.00
R7278:Olfr364-ps1 UTSW 2 37147009 missense probably benign 0.29
Z1088:Olfr364-ps1 UTSW 2 37146385 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATTGCAGGCCAGAGGATAG -3'
(R):5'- CAGTCGATCAATGGCCATGG -3'

Sequencing Primer
(F):5'- GGATAGGAGAAACATTGTCTTGATC -3'
(R):5'- CCATGGAGGCCAGCAGGTAG -3'
Posted On2015-01-11