Mutagenetix > Incidental Mutation

Incidental Mutation 'R2994:Ripor2'

257153

Institutional Source

Beutler Lab

Gene Symbol

Ripor2

Ensembl Gene

ENSMUSG00000036006

Gene Name

RHO family interacting cell polarization regulator 2

Synonyms

1700108N18Rik, E430013J17Rik, Fam65b, 6330500D04Rik

MMRRC Submission

040529-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R2994 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24685513-24917789 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24885610 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 576 (D576V)

Ref Sequence

ENSEMBL: ENSMUSP00000089286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]

AlphaFold

Q80U16

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038477
AA Change: D615V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: D615V

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC
low complexity region	461	476	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058009

SMART Domains

Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000091694
AA Change: D576V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: D576V

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
coiled coil region	111	140	N/A	INTRINSIC
low complexity region	422	437	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110383
AA Change: D590V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: D590V

Domain	Start	End	E-Value	Type
coiled coil region	83	112	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	630	639	N/A	INTRINSIC
low complexity region	657	672	N/A	INTRINSIC
low complexity region	857	864	N/A	INTRINSIC
SCOP:d1gw5a_	901	1023	2e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110384
AA Change: D615V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: D615V

Domain	Start	End	E-Value	Type
Pfam:PL48	41	389	6e-174	PFAM
low complexity region	461	476	N/A	INTRINSIC
low complexity region	655	664	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	882	889	N/A	INTRINSIC
SCOP:d1gw5a_	926	1048	2e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134370

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	C	17: 24,603,538 (GRCm39)	S577P	probably damaging	Het
Agrn	T	C	4: 156,251,785 (GRCm39)	T1826A	possibly damaging	Het
Arsi	G	A	18: 61,049,723 (GRCm39)	G202E	probably benign	Het
Btnl6	C	A	17: 34,734,498 (GRCm39)	R88I	possibly damaging	Het
Cfap52	T	A	11: 67,830,617 (GRCm39)	Y281F	probably benign	Het
CK137956	T	C	4: 127,845,300 (GRCm39)	T148A	probably benign	Het
Fpr3	C	T	17: 18,191,130 (GRCm39)	Q134*	probably null	Het
Gbp4	A	T	5: 105,284,886 (GRCm39)	M1K	probably null	Het
Gpsm1	G	A	2: 26,209,843 (GRCm39)		probably benign	Het
Nedd4	A	G	9: 72,638,185 (GRCm39)	D440G	probably benign	Het
Nlgn1	C	T	3: 25,490,162 (GRCm39)	D522N	probably damaging	Het
Oprk1	T	C	1: 5,672,955 (GRCm39)	V364A	probably benign	Het
Or1e35	T	C	11: 73,797,541 (GRCm39)	Y259C	probably damaging	Het
Or5d18	A	G	2: 87,865,301 (GRCm39)	Y61H	probably damaging	Het
Polr1e	T	C	4: 45,027,473 (GRCm39)		probably null	Het
Psmd11	T	C	11: 80,351,493 (GRCm39)	Y239H	probably damaging	Het
Rundc3a	C	T	11: 102,291,489 (GRCm39)	T327I	probably damaging	Het
Sh3rf1	A	G	8: 61,825,609 (GRCm39)	T535A	probably benign	Het
Slc13a2	T	A	11: 78,295,563 (GRCm39)	E101V	probably damaging	Het
Tg	A	T	15: 66,553,802 (GRCm39)	T406S	probably benign	Het
Tjp2	T	C	19: 24,090,215 (GRCm39)	E609G	probably damaging	Het
Zfp459	G	A	13: 67,556,853 (GRCm39)	P77S	possibly damaging	Het
Zfp612	A	G	8: 110,816,049 (GRCm39)	K380E	probably damaging	Het
Zfp629	T	C	7: 127,210,228 (GRCm39)	E527G	probably damaging	Het

Other mutations in Ripor2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Ripor2	APN	13	24,885,190 (GRCm39)	missense	probably benign	0.11
IGL02145:Ripor2	APN	13	24,901,554 (GRCm39)	missense	probably damaging	1.00
IGL02351:Ripor2	APN	13	24,915,572 (GRCm39)	missense	probably damaging	1.00
IGL02358:Ripor2	APN	13	24,915,572 (GRCm39)	missense	probably damaging	1.00
IGL02377:Ripor2	APN	13	24,879,549 (GRCm39)	splice site	probably benign
IGL02533:Ripor2	APN	13	24,885,378 (GRCm39)	nonsense	probably null
IGL02798:Ripor2	APN	13	24,858,649 (GRCm39)	missense	probably damaging	0.99
IGL02852:Ripor2	APN	13	24,879,681 (GRCm39)	missense	probably damaging	1.00
IGL02869:Ripor2	APN	13	24,880,512 (GRCm39)	missense	possibly damaging	0.46
IGL03219:Ripor2	APN	13	24,907,702 (GRCm39)	missense	probably damaging	1.00
gentleman	UTSW	13	24,878,128 (GRCm39)	missense	probably damaging	1.00
Jack	UTSW	13	24,861,824 (GRCm39)	nonsense	probably null
whitechapel	UTSW	13	24,857,095 (GRCm39)	critical splice donor site	probably null
R0045:Ripor2	UTSW	13	24,878,209 (GRCm39)	missense	probably damaging	1.00
R0101:Ripor2	UTSW	13	24,864,615 (GRCm39)	missense	probably damaging	1.00
R0731:Ripor2	UTSW	13	24,864,627 (GRCm39)	missense	probably damaging	1.00
R0827:Ripor2	UTSW	13	24,878,169 (GRCm39)	missense	probably damaging	1.00
R1331:Ripor2	UTSW	13	24,861,824 (GRCm39)	nonsense	probably null
R1374:Ripor2	UTSW	13	24,857,095 (GRCm39)	critical splice donor site	probably null
R1564:Ripor2	UTSW	13	24,859,768 (GRCm39)	missense	probably damaging	1.00
R1773:Ripor2	UTSW	13	24,885,237 (GRCm39)	missense	probably benign	0.10
R1889:Ripor2	UTSW	13	24,877,870 (GRCm39)	missense	probably damaging	1.00
R2122:Ripor2	UTSW	13	24,897,701 (GRCm39)	missense	probably damaging	0.98
R2137:Ripor2	UTSW	13	24,905,817 (GRCm39)	critical splice donor site	probably null
R2209:Ripor2	UTSW	13	24,885,595 (GRCm39)	missense	probably damaging	1.00
R2242:Ripor2	UTSW	13	24,855,755 (GRCm39)	missense	probably benign	0.08
R2392:Ripor2	UTSW	13	24,890,206 (GRCm39)	missense	probably benign	0.00
R4008:Ripor2	UTSW	13	24,880,521 (GRCm39)	missense	probably benign
R4287:Ripor2	UTSW	13	24,908,992 (GRCm39)	missense	probably damaging	1.00
R4364:Ripor2	UTSW	13	24,905,694 (GRCm39)	missense	probably benign	0.07
R4365:Ripor2	UTSW	13	24,905,694 (GRCm39)	missense	probably benign	0.07
R4366:Ripor2	UTSW	13	24,905,694 (GRCm39)	missense	probably benign	0.07
R4868:Ripor2	UTSW	13	24,878,124 (GRCm39)	missense	possibly damaging	0.88
R5304:Ripor2	UTSW	13	24,858,649 (GRCm39)	missense	probably damaging	0.99
R6119:Ripor2	UTSW	13	24,798,627 (GRCm39)	start gained	probably benign
R6157:Ripor2	UTSW	13	24,885,052 (GRCm39)	missense	probably damaging	1.00
R6178:Ripor2	UTSW	13	24,894,113 (GRCm39)	missense	possibly damaging	0.94
R6382:Ripor2	UTSW	13	24,861,828 (GRCm39)	missense	possibly damaging	0.89
R6664:Ripor2	UTSW	13	24,859,803 (GRCm39)	missense	probably damaging	0.98
R6908:Ripor2	UTSW	13	24,890,215 (GRCm39)	missense	probably damaging	1.00
R7023:Ripor2	UTSW	13	24,855,829 (GRCm39)	missense	probably benign	0.00
R7041:Ripor2	UTSW	13	24,877,749 (GRCm39)	missense	probably benign	0.18
R7196:Ripor2	UTSW	13	24,888,808 (GRCm39)	missense	possibly damaging	0.66
R7216:Ripor2	UTSW	13	24,855,886 (GRCm39)	missense	probably damaging	1.00
R7248:Ripor2	UTSW	13	24,878,128 (GRCm39)	missense	probably damaging	1.00
R7299:Ripor2	UTSW	13	24,908,984 (GRCm39)	missense	possibly damaging	0.54
R7301:Ripor2	UTSW	13	24,908,984 (GRCm39)	missense	possibly damaging	0.54
R7343:Ripor2	UTSW	13	24,885,427 (GRCm39)	nonsense	probably null
R7417:Ripor2	UTSW	13	24,880,533 (GRCm39)	missense	probably damaging	1.00
R7426:Ripor2	UTSW	13	24,878,188 (GRCm39)	missense	probably benign	0.01
R7448:Ripor2	UTSW	13	24,854,054 (GRCm39)	missense	possibly damaging	0.71
R7462:Ripor2	UTSW	13	24,880,290 (GRCm39)	missense	unknown
R7499:Ripor2	UTSW	13	24,877,755 (GRCm39)	missense	probably damaging	0.99
R8081:Ripor2	UTSW	13	24,897,683 (GRCm39)	missense	probably benign	0.01
R8157:Ripor2	UTSW	13	24,879,600 (GRCm39)	missense	probably benign	0.05
R8364:Ripor2	UTSW	13	24,894,176 (GRCm39)	missense	possibly damaging	0.95
R8447:Ripor2	UTSW	13	24,907,771 (GRCm39)	missense	probably damaging	1.00
R8465:Ripor2	UTSW	13	24,849,451 (GRCm39)	intron	probably benign
R8751:Ripor2	UTSW	13	24,885,050 (GRCm39)	missense	possibly damaging	0.69
R8818:Ripor2	UTSW	13	24,901,651 (GRCm39)	missense	possibly damaging	0.93
R8867:Ripor2	UTSW	13	24,822,760 (GRCm39)	intron	probably benign
R9079:Ripor2	UTSW	13	24,915,637 (GRCm39)	missense	probably benign	0.35
R9187:Ripor2	UTSW	13	24,897,632 (GRCm39)	missense	probably benign	0.01
R9316:Ripor2	UTSW	13	24,905,719 (GRCm39)	missense	probably benign	0.09
R9320:Ripor2	UTSW	13	24,915,663 (GRCm39)	missense	probably damaging	1.00
R9355:Ripor2	UTSW	13	24,885,694 (GRCm39)	missense	probably benign	0.00
R9655:Ripor2	UTSW	13	24,908,983 (GRCm39)	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- AATCGGATGAGGCCTCTGAG -3'
(R):5'- AGGTATACACTGGTCCTGTGAC -3'

Sequencing Primer
(F):5'- ATGAGGCCTCTGAGCTCAAG -3'
(R):5'- CTTGGTTCAGATCCTGGA -3'

Posted On

2015-01-11