Incidental Mutation 'R2994:Abca3'
ID257160
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene NameATP-binding cassette, sub-family A (ABC1), member 3
SynonymsABC-C, 1810036E22Rik, Abc3
MMRRC Submission 040529-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2994 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24351950-24410201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24384564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 577 (S577P)
Ref Sequence ENSEMBL: ENSMUSP00000078544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
Predicted Effect probably damaging
Transcript: ENSMUST00000039013
AA Change: S577P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: S577P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079594
AA Change: S577P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: S577P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117337
AA Change: S577P
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: S577P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148557
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn T C 4: 156,167,328 T1826A possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Btnl6 C A 17: 34,515,524 R88I possibly damaging Het
Cfap52 T A 11: 67,939,791 Y281F probably benign Het
CK137956 T C 4: 127,951,507 T148A probably benign Het
Fpr3 C T 17: 17,970,868 Q134* probably null Het
Gbp4 A T 5: 105,137,020 M1K probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Nedd4 A G 9: 72,730,903 D440G probably benign Het
Nlgn1 C T 3: 25,435,998 D522N probably damaging Het
Olfr395 T C 11: 73,906,715 Y259C probably damaging Het
Olfr73 A G 2: 88,034,957 Y61H probably damaging Het
Oprk1 T C 1: 5,602,732 V364A probably benign Het
Polr1e T C 4: 45,027,473 probably null Het
Psmd11 T C 11: 80,460,667 Y239H probably damaging Het
Ripor2 A T 13: 24,701,627 D576V probably damaging Het
Rundc3a C T 11: 102,400,663 T327I probably damaging Het
Sh3rf1 A G 8: 61,372,575 T535A probably benign Het
Slc13a2 T A 11: 78,404,737 E101V probably damaging Het
Tg A T 15: 66,681,953 T406S probably benign Het
Tjp2 T C 19: 24,112,851 E609G probably damaging Het
Zfp459 G A 13: 67,408,734 P77S possibly damaging Het
Zfp612 A G 8: 110,089,417 K380E probably damaging Het
Zfp629 T C 7: 127,611,056 E527G probably damaging Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1348:Abca3 UTSW 17 24374238 splice site probably null
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5022:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24384535 missense probably damaging 1.00
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTAGGGTCGTGTTCCAAAGG -3'
(R):5'- TCCCACCAGGTTTGAGCATTC -3'

Sequencing Primer
(F):5'- TCCAAAGGGAAAAGGAGGCCC -3'
(R):5'- CACCAGGTTTGAGCATTCATAGACAG -3'
Posted On2015-01-11