Incidental Mutation 'R2996:Rptor'
ID 257187
Institutional Source Beutler Lab
Gene Symbol Rptor
Ensembl Gene ENSMUSG00000025583
Gene Name regulatory associated protein of MTOR, complex 1
Synonyms Rap, raptor, 4932417H02Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2996 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 119493731-119790402 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119747124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 13 (V13D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000124401] [ENSMUST00000131217] [ENSMUST00000147781]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026671
AA Change: V672D

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: V672D

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Pfam:HEAT_2 559 668 7.9e-11 PFAM
Pfam:HEAT 602 630 1.9e-6 PFAM
low complexity region 755 772 N/A INTRINSIC
low complexity region 877 887 N/A INTRINSIC
low complexity region 939 945 N/A INTRINSIC
WD40 1012 1050 2.56e1 SMART
WD40 1052 1097 4.28e0 SMART
WD40 1105 1151 1.83e2 SMART
WD40 1154 1194 1.82e-2 SMART
WD40 1200 1240 5.35e-1 SMART
WD40 1246 1281 7.13e0 SMART
WD40 1283 1329 2.67e-1 SMART
Predicted Effect silent
Transcript: ENSMUST00000124401
SMART Domains Protein: ENSMUSP00000125503
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
Pfam:HEAT 58 88 1.2e-5 PFAM
Pfam:HEAT_2 101 170 3.9e-8 PFAM
Pfam:HEAT 102 130 1.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127899
Predicted Effect probably benign
Transcript: ENSMUST00000131217
SMART Domains Protein: ENSMUSP00000125667
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136662
AA Change: V13D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583
AA Change: V13D

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147781
SMART Domains Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148860
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid5b C T 10: 67,934,292 (GRCm39) G294S probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
F5 C A 1: 164,010,486 (GRCm39) R406S probably damaging Het
Fam43a A G 16: 30,419,838 (GRCm39) T141A possibly damaging Het
Gpsm1 G A 2: 26,209,843 (GRCm39) probably benign Het
Gtpbp3 G A 8: 71,942,140 (GRCm39) G125S possibly damaging Het
Lmbr1 A G 5: 29,568,931 (GRCm39) I30T probably benign Het
Map2k7 C A 8: 4,293,775 (GRCm39) N138K probably benign Het
Mdc1 TGAGGAGGAGGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGGAGGAGGAGG 17: 36,158,785 (GRCm39) probably benign Het
Mmab C A 5: 114,574,555 (GRCm39) R184L probably damaging Het
Nsun7 T A 5: 66,452,897 (GRCm39) H571Q probably benign Het
Pfkp A G 13: 6,685,966 (GRCm39) Y23H probably benign Het
Vmn1r90 T C 7: 14,295,459 (GRCm39) H213R probably damaging Het
Other mutations in Rptor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Rptor APN 11 119,690,271 (GRCm39) missense possibly damaging 0.92
IGL01319:Rptor APN 11 119,781,996 (GRCm39) missense probably benign 0.01
IGL01375:Rptor APN 11 119,787,262 (GRCm39) missense possibly damaging 0.68
IGL01899:Rptor APN 11 119,748,279 (GRCm39) missense probably benign 0.04
IGL01927:Rptor APN 11 119,548,500 (GRCm39) missense probably damaging 1.00
IGL02312:Rptor APN 11 119,737,741 (GRCm39) missense possibly damaging 0.84
IGL02620:Rptor APN 11 119,671,413 (GRCm39) missense probably benign 0.12
IGL02651:Rptor APN 11 119,783,438 (GRCm39) missense possibly damaging 0.69
IGL03182:Rptor APN 11 119,615,971 (GRCm39) missense probably damaging 1.00
Velocipede UTSW 11 119,786,803 (GRCm39) missense possibly damaging 0.92
R0103:Rptor UTSW 11 119,775,793 (GRCm39) missense probably benign 0.01
R0179:Rptor UTSW 11 119,763,193 (GRCm39) missense probably benign 0.14
R0217:Rptor UTSW 11 119,785,738 (GRCm39) splice site probably benign
R0219:Rptor UTSW 11 119,712,603 (GRCm39) intron probably benign
R0324:Rptor UTSW 11 119,783,467 (GRCm39) missense probably damaging 1.00
R0432:Rptor UTSW 11 119,671,379 (GRCm39) nonsense probably null
R0718:Rptor UTSW 11 119,763,202 (GRCm39) missense probably benign 0.15
R0730:Rptor UTSW 11 119,775,780 (GRCm39) missense probably benign 0.06
R1019:Rptor UTSW 11 119,734,569 (GRCm39) missense probably damaging 1.00
R1073:Rptor UTSW 11 119,634,717 (GRCm39) missense possibly damaging 0.93
R1424:Rptor UTSW 11 119,671,419 (GRCm39) nonsense probably null
R1579:Rptor UTSW 11 119,786,827 (GRCm39) missense probably benign 0.00
R1766:Rptor UTSW 11 119,615,887 (GRCm39) missense probably damaging 0.99
R1844:Rptor UTSW 11 119,647,146 (GRCm39) missense probably damaging 1.00
R2180:Rptor UTSW 11 119,615,970 (GRCm39) missense probably damaging 1.00
R2274:Rptor UTSW 11 119,647,148 (GRCm39) nonsense probably null
R2275:Rptor UTSW 11 119,647,148 (GRCm39) nonsense probably null
R2408:Rptor UTSW 11 119,748,277 (GRCm39) missense probably damaging 0.99
R2981:Rptor UTSW 11 119,756,420 (GRCm39) missense probably damaging 1.00
R3001:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R3002:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R3003:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R4358:Rptor UTSW 11 119,562,171 (GRCm39) missense probably damaging 0.98
R4592:Rptor UTSW 11 119,689,666 (GRCm39) missense probably null 1.00
R4647:Rptor UTSW 11 119,781,989 (GRCm39) missense probably benign 0.33
R4666:Rptor UTSW 11 119,634,708 (GRCm39) missense probably damaging 1.00
R4958:Rptor UTSW 11 119,748,217 (GRCm39) missense probably benign 0.29
R4974:Rptor UTSW 11 119,712,466 (GRCm39) intron probably benign
R5073:Rptor UTSW 11 119,787,305 (GRCm39) missense possibly damaging 0.71
R5199:Rptor UTSW 11 119,494,642 (GRCm39) missense probably benign
R5216:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5219:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5277:Rptor UTSW 11 119,713,782 (GRCm39) missense probably damaging 1.00
R5365:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5366:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5447:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5630:Rptor UTSW 11 119,647,075 (GRCm39) missense probably benign 0.01
R6220:Rptor UTSW 11 119,788,268 (GRCm39) missense possibly damaging 0.83
R6567:Rptor UTSW 11 119,786,838 (GRCm39) missense probably benign 0.00
R6741:Rptor UTSW 11 119,786,803 (GRCm39) missense possibly damaging 0.92
R6915:Rptor UTSW 11 119,647,171 (GRCm39) missense probably damaging 0.99
R7032:Rptor UTSW 11 119,737,762 (GRCm39) missense probably benign 0.00
R7051:Rptor UTSW 11 119,765,012 (GRCm39) utr 3 prime probably benign
R7396:Rptor UTSW 11 119,763,181 (GRCm39) missense probably benign 0.10
R7429:Rptor UTSW 11 119,737,654 (GRCm39) missense probably damaging 1.00
R7430:Rptor UTSW 11 119,737,654 (GRCm39) missense probably damaging 1.00
R7447:Rptor UTSW 11 119,775,805 (GRCm39) missense probably benign 0.00
R7595:Rptor UTSW 11 119,634,779 (GRCm39) missense possibly damaging 0.82
R7776:Rptor UTSW 11 119,783,453 (GRCm39) missense probably benign 0.01
R7854:Rptor UTSW 11 119,748,779 (GRCm39) missense probably benign 0.02
R8288:Rptor UTSW 11 119,748,763 (GRCm39) missense probably benign 0.02
R8305:Rptor UTSW 11 119,702,812 (GRCm39) missense probably damaging 1.00
R8328:Rptor UTSW 11 119,783,473 (GRCm39) missense probably benign 0.00
R8351:Rptor UTSW 11 119,783,465 (GRCm39) missense probably benign 0.22
R8772:Rptor UTSW 11 119,615,858 (GRCm39) missense probably damaging 1.00
R8871:Rptor UTSW 11 119,494,751 (GRCm39) missense probably benign 0.01
R8925:Rptor UTSW 11 119,782,036 (GRCm39) missense probably benign 0.11
R8927:Rptor UTSW 11 119,782,036 (GRCm39) missense probably benign 0.11
R8981:Rptor UTSW 11 119,734,508 (GRCm39) missense possibly damaging 0.90
R9149:Rptor UTSW 11 119,777,896 (GRCm39) missense probably benign 0.05
R9213:Rptor UTSW 11 119,494,765 (GRCm39) missense probably benign
R9224:Rptor UTSW 11 119,785,113 (GRCm39) missense probably benign 0.11
R9290:Rptor UTSW 11 119,702,823 (GRCm39) missense probably benign 0.00
R9314:Rptor UTSW 11 119,786,772 (GRCm39) missense probably benign 0.43
R9371:Rptor UTSW 11 119,562,152 (GRCm39) missense possibly damaging 0.66
R9719:Rptor UTSW 11 119,781,940 (GRCm39) missense probably benign 0.13
R9751:Rptor UTSW 11 119,777,964 (GRCm39) missense probably benign 0.02
X0050:Rptor UTSW 11 119,737,231 (GRCm39) missense probably benign 0.14
X0066:Rptor UTSW 11 119,748,692 (GRCm39) missense probably benign 0.31
Z0001:Rptor UTSW 11 119,762,318 (GRCm39) critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119,748,279 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,742,294 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,737,578 (GRCm39) critical splice acceptor site probably null
Z0001:Rptor UTSW 11 119,690,145 (GRCm39) critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119,647,241 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,647,062 (GRCm39) splice site probably null
Z0001:Rptor UTSW 11 119,494,798 (GRCm39) critical splice donor site probably null
Z0001:Rptor UTSW 11 119,787,375 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,764,977 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TTGGTGCCTAGCAATGAGC -3'
(R):5'- CTTCTAAAGGCCTGAGACACC -3'

Sequencing Primer
(F):5'- GAGACCCCTCTCGACAGC -3'
(R):5'- CGCATCAGAGAGCCATGC -3'
Posted On 2015-01-11