Incidental Mutation 'R2997:Adgrl2'
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Nameadhesion G protein-coupled receptor L2
SynonymsLec1, Lphn2, Lphh1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2997 (G1)
Quality Score225
Status Not validated
Chromosomal Location148815583-148990555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148817649 bp
Amino Acid Change Valine to Glutamic Acid at position 82 (V82E)
Ref Sequence ENSEMBL: ENSMUSP00000132116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000168352] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
Predicted Effect probably benign
Transcript: ENSMUST00000106128
AA Change: V1330E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: V1330E

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168352
AA Change: V82E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132116
Gene: ENSMUSG00000028184
AA Change: V82E

Pfam:Latrophilin 1 239 2.5e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195988
AA Change: V1278E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: V1278E

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196526
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197348
Predicted Effect possibly damaging
Transcript: ENSMUST00000197567
AA Change: V1330E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: V1330E

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197925
Predicted Effect unknown
Transcript: ENSMUST00000198139
AA Change: V313E
Predicted Effect possibly damaging
Transcript: ENSMUST00000198779
AA Change: V1295E

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: V1295E

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199059
AA Change: V1310E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: V1310E

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199238
AA Change: V1321E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: V1321E

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199750
AA Change: V1184E

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: V1184E

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200023
Predicted Effect probably benign
Transcript: ENSMUST00000200154
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200216
Predicted Effect probably benign
Transcript: ENSMUST00000200456
Predicted Effect probably damaging
Transcript: ENSMUST00000200543
AA Change: V1246E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: V1246E

signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl6 A T 16: 59,623,876 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Elp4 A G 2: 105,814,316 F228L possibly damaging Het
Fndc3b A C 3: 27,468,872 D519E probably benign Het
Gbp9 T A 5: 105,082,769 I430F probably benign Het
Gm4737 G A 16: 46,153,925 T363I possibly damaging Het
Lgr4 A T 2: 110,003,517 E369D probably benign Het
Lrguk T A 6: 34,073,762 V385D probably damaging Het
Mier1 T A 4: 103,131,036 D52E probably damaging Het
Mthfd1 G T 12: 76,315,036 V139F probably benign Het
Myg1 G T 15: 102,337,510 R315L probably null Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Ttn A G 2: 76,886,006 probably benign Het
Tyw5 T C 1: 57,388,641 D268G probably damaging Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148865608 missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148826498 missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148836527 missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148858975 missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148828489 nonsense probably null
IGL02468:Adgrl2 APN 3 148890480 missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148826525 missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148890605 missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148817400 missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148859380 missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148859063 missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148817298 missense
PIT4544001:Adgrl2 UTSW 3 148890521 missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148852863 splice site probably benign
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0344:Adgrl2 UTSW 3 148865595 splice site probably null
R0488:Adgrl2 UTSW 3 148846905 missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148859218 missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148839244 missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148837679 missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148822981 missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148859273 missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148852762 missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148865608 missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148852593 missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148817244 missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148826475 missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148851934 missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148817551 missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148858963 missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148817235 missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148839152 missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148859020 missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148890463 missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148823036 missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148823713 missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148817844 missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148837562 critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148859164 missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148859175 missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148823009 missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148858942 missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148826507 missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148817286 missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148846929 missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148858949 missense probably damaging 1.00
R7326:Adgrl2 UTSW 3 148846870 missense probably benign 0.00
R7348:Adgrl2 UTSW 3 148817766 missense
R7382:Adgrl2 UTSW 3 148817283 missense
X0009:Adgrl2 UTSW 3 148852654 missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148865594 splice site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-01-11