Incidental Mutation 'R2999:Tmem121b'
ID257230
Institutional Source Beutler Lab
Gene Symbol Tmem121b
Ensembl Gene ENSMUSG00000094626
Gene Nametransmembrane protein 121B
SynonymsCecr6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2999 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location120488939-120493807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120492982 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 258 (N258S)
Ref Sequence ENSEMBL: ENSMUSP00000135924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178687]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178687
AA Change: N258S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135924
Gene: ENSMUSG00000094626
AA Change: N258S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 88 193 N/A INTRINSIC
low complexity region 196 215 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 253 271 N/A INTRINSIC
low complexity region 273 305 N/A INTRINSIC
Pfam:CECR6_TMEM121 308 512 3.6e-61 PFAM
low complexity region 521 550 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1a T C 8: 84,567,742 L1178P probably damaging Het
Ccdc162 T C 10: 41,580,290 M1619V probably benign Het
Diaph3 C T 14: 86,772,094 C1083Y probably damaging Het
Dyrk3 A T 1: 131,129,446 I330N probably damaging Het
Fmn1 A G 2: 113,365,094 T380A unknown Het
Inhbe T C 10: 127,351,374 T58A possibly damaging Het
Lama2 C T 10: 26,989,421 A2914T probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Sf1 C T 19: 6,374,876 probably benign Het
Tmem260 T A 14: 48,484,989 L327Q possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Zcchc2 A G 1: 106,030,024 M742V probably benign Het
Other mutations in Tmem121b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Tmem121b APN 6 120492466 missense probably damaging 1.00
IGL02220:Tmem121b APN 6 120492337 missense probably damaging 1.00
R2256:Tmem121b UTSW 6 120492069 nonsense probably null
R2256:Tmem121b UTSW 6 120492071 missense probably damaging 1.00
R2257:Tmem121b UTSW 6 120492069 nonsense probably null
R2257:Tmem121b UTSW 6 120492071 missense probably damaging 1.00
R3833:Tmem121b UTSW 6 120492880 missense probably damaging 1.00
R4583:Tmem121b UTSW 6 120492094 missense probably damaging 0.99
R4752:Tmem121b UTSW 6 120493034 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CCTTAGGGGTGAAAGCGATG -3'
(R):5'- TTAGCATCAGCAAGCCACTG -3'

Sequencing Primer
(F):5'- TGGAGTAGATGAGCCAGGCC -3'
(R):5'- TTCCTGCAGCATGACCG -3'
Posted On2015-01-11