Incidental Mutation 'R3002:Folh1'
ID257281
Institutional Source Beutler Lab
Gene Symbol Folh1
Ensembl Gene ENSMUSG00000001773
Gene Namefolate hydrolase 1
Synonymsprostate-specific membrane antigen, glutamate carboxypeptidase II, mopsm, GCP2
MMRRC Submission 040531-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3002 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86718977-86775943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86723311 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 678 (I678M)
Ref Sequence ENSEMBL: ENSMUSP00000001824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001824] [ENSMUST00000107271]
Predicted Effect probably damaging
Transcript: ENSMUST00000001824
AA Change: I678M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001824
Gene: ENSMUSG00000001773
AA Change: I678M

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 171 264 2.5e-16 PFAM
Pfam:Peptidase_M28 359 561 1.2e-18 PFAM
Pfam:TFR_dimer 629 749 1.6e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107271
AA Change: I645M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102892
Gene: ENSMUSG00000001773
AA Change: I645M

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 167 265 7e-18 PFAM
Pfam:Peptidase_M28 339 475 2.1e-15 PFAM
Pfam:TFR_dimer 595 718 1.1e-43 PFAM
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in protection from peripheral neuropathy and ischemic brain injury. Homozygotes for a null allele show increased food intake, anxiety-like behavior, smaller sciatic nerve axons, and impaired angiogenesis. Homozygotes for a different null allele show less neuron degeneration and astrocyte damage after traumatic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,080 W40R possibly damaging Het
A2m A G 6: 121,661,447 S873G possibly damaging Het
Acd C T 8: 105,700,281 probably null Het
Acly T C 11: 100,504,227 K469E possibly damaging Het
Adcy6 T C 15: 98,596,660 T767A probably benign Het
Bnip3 T C 7: 138,894,701 I93V probably benign Het
Casq2 A G 3: 102,145,201 D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 D182G probably benign Het
Cep112 A G 11: 108,440,503 E178G probably damaging Het
Chrd T G 16: 20,737,445 Y585* probably null Het
Cnksr3 T C 10: 7,152,856 probably benign Het
Csmd1 A G 8: 16,196,170 F1072L probably damaging Het
Dnaic2 C T 11: 114,750,471 P374L probably damaging Het
Eif4g1 T A 16: 20,692,384 F1289I probably damaging Het
Eprs T C 1: 185,424,391 probably null Het
Fam105a T C 15: 27,664,706 T55A probably benign Het
Fasn T C 11: 120,809,845 D2114G probably benign Het
Fbxl17 T A 17: 63,225,077 E590D probably damaging Het
Flnb G T 14: 7,907,162 R1245L probably benign Het
Frrs1l G T 4: 56,990,139 probably benign Het
Hal G A 10: 93,507,519 A542T probably damaging Het
Hs3st2 T A 7: 121,500,687 M252K probably damaging Het
Il27ra G T 8: 84,032,031 S499* probably null Het
Klhdc1 T A 12: 69,256,209 V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lnx2 A G 5: 147,019,015 V657A probably benign Het
Lrig1 G A 6: 94,608,777 S810L probably damaging Het
Lyst A T 13: 13,696,705 M2676L probably benign Het
Mindy4 T A 6: 55,218,364 S188T probably benign Het
Mrgprb3 C T 7: 48,643,484 M106I probably benign Het
Ncam1 A G 9: 49,557,226 I311T probably damaging Het
Ndufa8 T A 2: 36,036,559 E155V possibly damaging Het
Nr4a1 A G 15: 101,270,972 probably null Het
Olfr446 A G 6: 42,927,954 H241R probably damaging Het
Orc3 T C 4: 34,571,790 T660A probably benign Het
Otub2 T C 12: 103,404,277 S273P probably damaging Het
Phf11c A G 14: 59,384,840 L241P probably damaging Het
Pik3ca T A 3: 32,462,797 I1058N probably damaging Het
Pkd2l1 A G 19: 44,155,557 F359S possibly damaging Het
Plxnc1 A T 10: 94,793,218 F1565I probably damaging Het
Polr1a A G 6: 71,913,016 N73S probably benign Het
Polr1a T A 6: 71,965,644 V1156E probably benign Het
Pon2 A G 6: 5,268,976 probably null Het
Ptcd1 G A 5: 145,159,576 L236F probably damaging Het
Rgl2 A G 17: 33,932,605 I208V probably benign Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Rptor G A 11: 119,872,371 R927Q possibly damaging Het
Sec14l5 A G 16: 5,171,882 Y230C probably damaging Het
Sele G T 1: 164,053,571 G447C probably damaging Het
Slc17a1 G A 13: 23,878,581 probably null Het
Slc2a4 A T 11: 69,945,925 Y159* probably null Het
Slitrk5 A G 14: 111,679,582 K213E probably damaging Het
Tdrd1 C A 19: 56,861,750 Y981* probably null Het
Tex15 T C 8: 33,574,528 Y1329H probably benign Het
Tgif2 C G 2: 156,844,194 S2W probably damaging Het
Thoc5 A G 11: 4,928,688 M620V probably benign Het
Tmeff2 C T 1: 51,181,835 A323V probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A C 4: 3,569,588 L34W probably damaging Het
Tmtc4 A T 14: 122,932,818 probably null Het
Trpm2 A T 10: 77,930,534 probably null Het
Tyk2 C A 9: 21,109,321 R938L probably benign Het
Usp33 A T 3: 152,357,942 T18S probably damaging Het
V1rd19 A T 7: 24,003,885 I259F probably benign Het
Vmn2r24 A C 6: 123,804,272 Q479P probably benign Het
Vmn2r98 A G 17: 19,065,863 M208V probably benign Het
Wfdc6a C T 2: 164,580,305 V125I probably benign Het
Zcchc11 G A 4: 108,512,928 E714K probably damaging Het
Zkscan17 A G 11: 59,487,251 C369R probably damaging Het
Other mutations in Folh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Folh1 APN 7 86734143 missense probably damaging 1.00
IGL00531:Folh1 APN 7 86719769 missense possibly damaging 0.82
IGL00772:Folh1 APN 7 86731784 missense probably damaging 1.00
IGL01339:Folh1 APN 7 86726098 missense probably damaging 1.00
IGL01373:Folh1 APN 7 86746142 missense probably benign 0.39
IGL01645:Folh1 APN 7 86742227 missense probably damaging 1.00
IGL01736:Folh1 APN 7 86742236 missense possibly damaging 0.96
IGL02104:Folh1 APN 7 86744430 missense possibly damaging 0.93
IGL02124:Folh1 APN 7 86725418 missense probably damaging 0.99
IGL02338:Folh1 APN 7 86736515 splice site probably benign
IGL02440:Folh1 APN 7 86734104 missense probably benign 0.09
IGL02689:Folh1 APN 7 86763045 splice site probably null
IGL02976:Folh1 APN 7 86762918 missense probably benign
IGL03022:Folh1 APN 7 86746171 missense possibly damaging 0.76
R0090:Folh1 UTSW 7 86725868 splice site probably benign
R0285:Folh1 UTSW 7 86742165 splice site probably benign
R0482:Folh1 UTSW 7 86746101 splice site probably benign
R0492:Folh1 UTSW 7 86746192 missense probably damaging 1.00
R1079:Folh1 UTSW 7 86771881 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1493:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1778:Folh1 UTSW 7 86761699 critical splice donor site probably null
R1865:Folh1 UTSW 7 86725906 missense possibly damaging 0.65
R1878:Folh1 UTSW 7 86771742 missense probably benign
R1906:Folh1 UTSW 7 86742166 splice site probably null
R1912:Folh1 UTSW 7 86762967 missense possibly damaging 0.95
R2263:Folh1 UTSW 7 86719765 missense probably benign
R3001:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3883:Folh1 UTSW 7 86775656 missense possibly damaging 0.48
R4061:Folh1 UTSW 7 86756962 missense possibly damaging 0.49
R4277:Folh1 UTSW 7 86762915 critical splice donor site probably null
R4507:Folh1 UTSW 7 86757008 missense probably benign
R4627:Folh1 UTSW 7 86773252 missense probably benign 0.00
R4652:Folh1 UTSW 7 86744425 nonsense probably null
R4653:Folh1 UTSW 7 86744425 nonsense probably null
R4745:Folh1 UTSW 7 86723274 critical splice donor site probably null
R5571:Folh1 UTSW 7 86734120 missense probably damaging 1.00
R6000:Folh1 UTSW 7 86725934 missense probably benign 0.01
R6307:Folh1 UTSW 7 86723309 missense probably damaging 1.00
R6474:Folh1 UTSW 7 86775756 missense probably damaging 0.99
R7112:Folh1 UTSW 7 86775637 critical splice donor site probably null
R7131:Folh1 UTSW 7 86726112 missense probably damaging 1.00
Z1088:Folh1 UTSW 7 86725954 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGACAAGGGACAACTTAC -3'
(R):5'- ACTGGATACCTTTGGTCATGAC -3'

Sequencing Primer
(F):5'- GAAGAACAATGTGCATGTAAAATCCC -3'
(R):5'- GCAACCTGTTCAGTTTCTGTAATG -3'
Posted On2015-01-11