Incidental Mutation 'R3002:Ncam1'
ID257288
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
MMRRC Submission 040531-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R3002 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49557226 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 311 (I311T)
Ref Sequence ENSEMBL: ENSMUSP00000141700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000192584] [ENSMUST00000193547]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068730
Predicted Effect probably damaging
Transcript: ENSMUST00000114476
AA Change: I311T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542
AA Change: I311T

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
low complexity region 711 725 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166811
AA Change: I311T
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542
AA Change: I311T

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192584
AA Change: I311T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141700
Gene: ENSMUSG00000039542
AA Change: I311T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 1.2e-6 SMART
IGc2 130 196 2.6e-8 SMART
IGc2 226 295 2.6e-22 SMART
IGc2 321 393 1.6e-16 SMART
IGc2 418 487 4e-13 SMART
FN3 501 586 2.4e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193547
AA Change: I311T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542
AA Change: I311T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194252
AA Change: I268T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216483
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,080 W40R possibly damaging Het
A2m A G 6: 121,661,447 S873G possibly damaging Het
Acd C T 8: 105,700,281 probably null Het
Acly T C 11: 100,504,227 K469E possibly damaging Het
Adcy6 T C 15: 98,596,660 T767A probably benign Het
Bnip3 T C 7: 138,894,701 I93V probably benign Het
Casq2 A G 3: 102,145,201 D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 D182G probably benign Het
Cep112 A G 11: 108,440,503 E178G probably damaging Het
Chrd T G 16: 20,737,445 Y585* probably null Het
Cnksr3 T C 10: 7,152,856 probably benign Het
Csmd1 A G 8: 16,196,170 F1072L probably damaging Het
Dnaic2 C T 11: 114,750,471 P374L probably damaging Het
Eif4g1 T A 16: 20,692,384 F1289I probably damaging Het
Eprs T C 1: 185,424,391 probably null Het
Fam105a T C 15: 27,664,706 T55A probably benign Het
Fasn T C 11: 120,809,845 D2114G probably benign Het
Fbxl17 T A 17: 63,225,077 E590D probably damaging Het
Flnb G T 14: 7,907,162 R1245L probably benign Het
Folh1 A C 7: 86,723,311 I678M probably damaging Het
Frrs1l G T 4: 56,990,139 probably benign Het
Hal G A 10: 93,507,519 A542T probably damaging Het
Hs3st2 T A 7: 121,500,687 M252K probably damaging Het
Il27ra G T 8: 84,032,031 S499* probably null Het
Klhdc1 T A 12: 69,256,209 V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lnx2 A G 5: 147,019,015 V657A probably benign Het
Lrig1 G A 6: 94,608,777 S810L probably damaging Het
Lyst A T 13: 13,696,705 M2676L probably benign Het
Mindy4 T A 6: 55,218,364 S188T probably benign Het
Mrgprb3 C T 7: 48,643,484 M106I probably benign Het
Ndufa8 T A 2: 36,036,559 E155V possibly damaging Het
Nr4a1 A G 15: 101,270,972 probably null Het
Olfr446 A G 6: 42,927,954 H241R probably damaging Het
Orc3 T C 4: 34,571,790 T660A probably benign Het
Otub2 T C 12: 103,404,277 S273P probably damaging Het
Phf11c A G 14: 59,384,840 L241P probably damaging Het
Pik3ca T A 3: 32,462,797 I1058N probably damaging Het
Pkd2l1 A G 19: 44,155,557 F359S possibly damaging Het
Plxnc1 A T 10: 94,793,218 F1565I probably damaging Het
Polr1a A G 6: 71,913,016 N73S probably benign Het
Polr1a T A 6: 71,965,644 V1156E probably benign Het
Pon2 A G 6: 5,268,976 probably null Het
Ptcd1 G A 5: 145,159,576 L236F probably damaging Het
Rgl2 A G 17: 33,932,605 I208V probably benign Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Rptor G A 11: 119,872,371 R927Q possibly damaging Het
Sec14l5 A G 16: 5,171,882 Y230C probably damaging Het
Sele G T 1: 164,053,571 G447C probably damaging Het
Slc17a1 G A 13: 23,878,581 probably null Het
Slc2a4 A T 11: 69,945,925 Y159* probably null Het
Slitrk5 A G 14: 111,679,582 K213E probably damaging Het
Tdrd1 C A 19: 56,861,750 Y981* probably null Het
Tex15 T C 8: 33,574,528 Y1329H probably benign Het
Tgif2 C G 2: 156,844,194 S2W probably damaging Het
Thoc5 A G 11: 4,928,688 M620V probably benign Het
Tmeff2 C T 1: 51,181,835 A323V probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A C 4: 3,569,588 L34W probably damaging Het
Tmtc4 A T 14: 122,932,818 probably null Het
Trpm2 A T 10: 77,930,534 probably null Het
Tyk2 C A 9: 21,109,321 R938L probably benign Het
Usp33 A T 3: 152,357,942 T18S probably damaging Het
V1rd19 A T 7: 24,003,885 I259F probably benign Het
Vmn2r24 A C 6: 123,804,272 Q479P probably benign Het
Vmn2r98 A G 17: 19,065,863 M208V probably benign Het
Wfdc6a C T 2: 164,580,305 V125I probably benign Het
Zcchc11 G A 4: 108,512,928 E714K probably damaging Het
Zkscan17 A G 11: 59,487,251 C369R probably damaging Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTTCCCATGTGCCAAAG -3'
(R):5'- TTGTCAGAATGCGTGGGAGTAC -3'

Sequencing Primer
(F):5'- GGTAGTGTCTCAAGTCTGCATCC -3'
(R):5'- GGAGTACAAGTCTGTGTCTCCTAC -3'
Posted On2015-01-11