Incidental Mutation 'R3002:Trpm2'
ID257290
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 040531-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R3002 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 77930534 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably null
Transcript: ENSMUST00000105401
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153842
Meta Mutation Damage Score 0.56 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,080 W40R possibly damaging Het
A2m A G 6: 121,661,447 S873G possibly damaging Het
Acd C T 8: 105,700,281 probably null Het
Acly T C 11: 100,504,227 K469E possibly damaging Het
Adcy6 T C 15: 98,596,660 T767A probably benign Het
Bnip3 T C 7: 138,894,701 I93V probably benign Het
Casq2 A G 3: 102,145,201 D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 D182G probably benign Het
Cep112 A G 11: 108,440,503 E178G probably damaging Het
Chrd T G 16: 20,737,445 Y585* probably null Het
Cnksr3 T C 10: 7,152,856 probably benign Het
Csmd1 A G 8: 16,196,170 F1072L probably damaging Het
Dnaic2 C T 11: 114,750,471 P374L probably damaging Het
Eif4g1 T A 16: 20,692,384 F1289I probably damaging Het
Eprs T C 1: 185,424,391 probably null Het
Fam105a T C 15: 27,664,706 T55A probably benign Het
Fasn T C 11: 120,809,845 D2114G probably benign Het
Fbxl17 T A 17: 63,225,077 E590D probably damaging Het
Flnb G T 14: 7,907,162 R1245L probably benign Het
Folh1 A C 7: 86,723,311 I678M probably damaging Het
Frrs1l G T 4: 56,990,139 probably benign Het
Hal G A 10: 93,507,519 A542T probably damaging Het
Hs3st2 T A 7: 121,500,687 M252K probably damaging Het
Il27ra G T 8: 84,032,031 S499* probably null Het
Klhdc1 T A 12: 69,256,209 V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lnx2 A G 5: 147,019,015 V657A probably benign Het
Lrig1 G A 6: 94,608,777 S810L probably damaging Het
Lyst A T 13: 13,696,705 M2676L probably benign Het
Mindy4 T A 6: 55,218,364 S188T probably benign Het
Mrgprb3 C T 7: 48,643,484 M106I probably benign Het
Ncam1 A G 9: 49,557,226 I311T probably damaging Het
Ndufa8 T A 2: 36,036,559 E155V possibly damaging Het
Nr4a1 A G 15: 101,270,972 probably null Het
Olfr446 A G 6: 42,927,954 H241R probably damaging Het
Orc3 T C 4: 34,571,790 T660A probably benign Het
Otub2 T C 12: 103,404,277 S273P probably damaging Het
Phf11c A G 14: 59,384,840 L241P probably damaging Het
Pik3ca T A 3: 32,462,797 I1058N probably damaging Het
Pkd2l1 A G 19: 44,155,557 F359S possibly damaging Het
Plxnc1 A T 10: 94,793,218 F1565I probably damaging Het
Polr1a A G 6: 71,913,016 N73S probably benign Het
Polr1a T A 6: 71,965,644 V1156E probably benign Het
Pon2 A G 6: 5,268,976 probably null Het
Ptcd1 G A 5: 145,159,576 L236F probably damaging Het
Rgl2 A G 17: 33,932,605 I208V probably benign Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Rptor G A 11: 119,872,371 R927Q possibly damaging Het
Sec14l5 A G 16: 5,171,882 Y230C probably damaging Het
Sele G T 1: 164,053,571 G447C probably damaging Het
Slc17a1 G A 13: 23,878,581 probably null Het
Slc2a4 A T 11: 69,945,925 Y159* probably null Het
Slitrk5 A G 14: 111,679,582 K213E probably damaging Het
Tdrd1 C A 19: 56,861,750 Y981* probably null Het
Tex15 T C 8: 33,574,528 Y1329H probably benign Het
Tgif2 C G 2: 156,844,194 S2W probably damaging Het
Thoc5 A G 11: 4,928,688 M620V probably benign Het
Tmeff2 C T 1: 51,181,835 A323V probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A C 4: 3,569,588 L34W probably damaging Het
Tmtc4 A T 14: 122,932,818 probably null Het
Tyk2 C A 9: 21,109,321 R938L probably benign Het
Usp33 A T 3: 152,357,942 T18S probably damaging Het
V1rd19 A T 7: 24,003,885 I259F probably benign Het
Vmn2r24 A C 6: 123,804,272 Q479P probably benign Het
Vmn2r98 A G 17: 19,065,863 M208V probably benign Het
Wfdc6a C T 2: 164,580,305 V125I probably benign Het
Zcchc11 G A 4: 108,512,928 E714K probably damaging Het
Zkscan17 A G 11: 59,487,251 C369R probably damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGACTGCAACCCAAGATGG -3'
(R):5'- AAGGGTTTTGCTTCTGTGACAC -3'

Sequencing Primer
(F):5'- TGGATAAAGAGCAGTCACACAC -3'
(R):5'- CACGGATAGAGATGTTGGCCTC -3'
Posted On2015-01-11