Incidental Mutation 'R0325:Atp7b'
ID25731
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene NameATPase, Cu++ transporting, beta polypeptide
SynonymsAtp7a, WND, Wilson protein
MMRRC Submission 038535-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R0325 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location21992785-22060305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22028451 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 124 (L124F)
Ref Sequence ENSEMBL: ENSMUSP00000006742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]
Predicted Effect probably benign
Transcript: ENSMUST00000006742
AA Change: L124F

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: L124F

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110738
AA Change: L112F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: L112F

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
Crb1 A C 1: 139,241,166 C871W probably damaging Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fmn2 T A 1: 174,609,954 probably null Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Galnt6 A T 15: 100,693,471 probably null Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lama3 A C 18: 12,482,126 D1369A probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Papola T A 12: 105,807,193 I157N probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc4a2 A T 5: 24,435,943 I747F probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Spata16 A G 3: 26,667,456 E42G probably damaging Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Unc80 G T 1: 66,510,881 G766V probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22011098 missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22027527 splice site probably null
IGL01600:Atp7b APN 8 22027525 splice site probably null
IGL01713:Atp7b APN 8 22028573 missense probably damaging 1.00
IGL01778:Atp7b APN 8 21994828 missense probably benign 0.42
IGL01926:Atp7b APN 8 22011781 missense probably damaging 0.98
IGL02312:Atp7b APN 8 21994770 missense probably damaging 0.99
IGL02562:Atp7b APN 8 22028085 missense probably benign
IGL02573:Atp7b APN 8 22022470 missense probably benign 0.00
IGL02603:Atp7b APN 8 21994776 missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22028438 missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22022477 missense probably benign 0.00
IGL03145:Atp7b APN 8 22018143 missense probably damaging 1.00
daffodil UTSW 8 21998266 missense probably damaging 1.00
PIT4131001:Atp7b UTSW 8 21994656 missense probably damaging 1.00
R0023:Atp7b UTSW 8 22011073 missense probably damaging 1.00
R0046:Atp7b UTSW 8 22059995 missense probably benign 0.00
R0128:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0412:Atp7b UTSW 8 21995659 splice site probably null
R0856:Atp7b UTSW 8 21997631 missense probably damaging 1.00
R0906:Atp7b UTSW 8 22027826 missense probably benign
R0989:Atp7b UTSW 8 22028694 missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22011785 missense probably benign 0.17
R1517:Atp7b UTSW 8 21997358 missense probably damaging 1.00
R1521:Atp7b UTSW 8 22027673 missense probably damaging 0.96
R1529:Atp7b UTSW 8 22028724 missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22006387 missense probably damaging 1.00
R1815:Atp7b UTSW 8 22011651 missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22027980 missense probably damaging 1.00
R2133:Atp7b UTSW 8 22011077 missense probably damaging 1.00
R2155:Atp7b UTSW 8 22013584 missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22014547 missense probably damaging 0.99
R2256:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2257:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2274:Atp7b UTSW 8 22020832 missense probably benign 0.20
R2475:Atp7b UTSW 8 21994776 missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R2907:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R3421:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3422:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3688:Atp7b UTSW 8 22004230 missense probably damaging 1.00
R3945:Atp7b UTSW 8 22020864 missense probably benign 0.02
R4235:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4701:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4877:Atp7b UTSW 8 22028601 missense probably damaging 0.98
R4962:Atp7b UTSW 8 22020885 missense probably damaging 1.00
R5009:Atp7b UTSW 8 22027698 missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22015869 splice site probably null
R5038:Atp7b UTSW 8 22028456 missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22014554 missense probably benign
R5467:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R5468:Atp7b UTSW 8 22059970 critical splice donor site probably null
R5512:Atp7b UTSW 8 22012739 missense probably benign 0.20
R5563:Atp7b UTSW 8 22028714 missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22018128 missense probably damaging 1.00
R5773:Atp7b UTSW 8 22027863 missense probably benign
R5941:Atp7b UTSW 8 21997496 missense probably damaging 0.98
R6227:Atp7b UTSW 8 22020825 missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22015927 nonsense probably null
R6290:Atp7b UTSW 8 22020820 missense probably damaging 1.00
R6368:Atp7b UTSW 8 22020755 splice site probably null
R6647:Atp7b UTSW 8 22028478 missense probably damaging 1.00
R6788:Atp7b UTSW 8 22004375 missense probably benign 0.37
R6830:Atp7b UTSW 8 22022365 missense probably damaging 0.97
R6886:Atp7b UTSW 8 22028690 missense probably benign 0.01
R6928:Atp7b UTSW 8 21994812 missense probably benign
R6965:Atp7b UTSW 8 22028085 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGCCCTCGATAGAGCTGACAC -3'
(R):5'- CAATCAATGAAGCAGAGCTTCGCC -3'

Sequencing Primer
(F):5'- CAGGACTGACAGGTCATGC -3'
(R):5'- GAGCTTCGCCTTCGACAATG -3'
Posted On2013-04-16