Incidental Mutation 'R3001:Vmn2r98'
ID257348
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 040530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R3001 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19065863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 208 (M208V)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: M208V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: M208V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,080 W40R possibly damaging Het
A2m A G 6: 121,661,447 S873G possibly damaging Het
Acd C T 8: 105,700,281 probably null Het
Acly T C 11: 100,504,227 K469E possibly damaging Het
Adcy6 T C 15: 98,596,660 T767A probably benign Het
Bnip3 T C 7: 138,894,701 I93V probably benign Het
Casq2 A G 3: 102,145,201 D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 D182G probably benign Het
Cep112 A G 11: 108,440,503 E178G probably damaging Het
Chrd T G 16: 20,737,445 Y585* probably null Het
Csmd1 A G 8: 16,196,170 F1072L probably damaging Het
Dnaic2 C T 11: 114,750,471 P374L probably damaging Het
Eif4g1 T A 16: 20,692,384 F1289I probably damaging Het
Eprs T C 1: 185,424,391 probably null Het
Fam105a T C 15: 27,664,706 T55A probably benign Het
Fasn T C 11: 120,809,845 D2114G probably benign Het
Fbxl17 T A 17: 63,225,077 E590D probably damaging Het
Flnb G T 14: 7,907,162 R1245L probably benign Het
Folh1 A C 7: 86,723,311 I678M probably damaging Het
Hal G A 10: 93,507,519 A542T probably damaging Het
Hs3st2 T A 7: 121,500,687 M252K probably damaging Het
Il27ra G T 8: 84,032,031 S499* probably null Het
Klhdc1 T A 12: 69,256,209 V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Krt71 C T 15: 101,740,471 probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lnx2 A G 5: 147,019,015 V657A probably benign Het
Lrig1 G A 6: 94,608,777 S810L probably damaging Het
Lyst A T 13: 13,696,705 M2676L probably benign Het
Mindy4 T A 6: 55,218,364 S188T probably benign Het
Mrgprb3 C T 7: 48,643,484 M106I probably benign Het
Ncam1 A G 9: 49,557,226 I311T probably damaging Het
Ndufa8 T A 2: 36,036,559 E155V possibly damaging Het
Nr4a1 A G 15: 101,270,972 probably null Het
Olfr446 A G 6: 42,927,954 H241R probably damaging Het
Orc3 T C 4: 34,571,790 T660A probably benign Het
Otub2 T C 12: 103,404,277 S273P probably damaging Het
Phf11c A G 14: 59,384,840 L241P probably damaging Het
Pik3ca T A 3: 32,462,797 I1058N probably damaging Het
Pkd2l1 A G 19: 44,155,557 F359S possibly damaging Het
Plxnc1 A T 10: 94,793,218 F1565I probably damaging Het
Polr1a T A 6: 71,965,644 V1156E probably benign Het
Polr1a A G 6: 71,913,016 N73S probably benign Het
Pon2 A G 6: 5,268,976 probably null Het
Ptcd1 G A 5: 145,159,576 L236F probably damaging Het
Rgl2 A G 17: 33,932,605 I208V probably benign Het
Rptor G A 11: 119,872,371 R927Q possibly damaging Het
Sacm1l T C 9: 123,585,084 probably benign Het
Sec14l5 A G 16: 5,171,882 Y230C probably damaging Het
Sele G T 1: 164,053,571 G447C probably damaging Het
Slc17a1 G A 13: 23,878,581 probably null Het
Slc2a4 A T 11: 69,945,925 Y159* probably null Het
Slitrk5 A G 14: 111,679,582 K213E probably damaging Het
Tdrd1 C A 19: 56,861,750 Y981* probably null Het
Tex15 T C 8: 33,574,528 Y1329H probably benign Het
Tgif2 C G 2: 156,844,194 S2W probably damaging Het
Thoc5 A G 11: 4,928,688 M620V probably benign Het
Tmeff2 C T 1: 51,181,835 A323V probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A C 4: 3,569,588 L34W probably damaging Het
Tmtc4 A T 14: 122,932,818 probably null Het
Trpm2 A T 10: 77,930,534 probably null Het
Tyk2 C A 9: 21,109,321 R938L probably benign Het
Usp33 A T 3: 152,357,942 T18S probably damaging Het
V1rd19 A T 7: 24,003,885 I259F probably benign Het
Vmn2r24 A C 6: 123,804,272 Q479P probably benign Het
Wfdc6a C T 2: 164,580,305 V125I probably benign Het
Xpo7 A G 14: 70,692,645 probably benign Het
Zcchc11 G A 4: 108,512,928 E714K probably damaging Het
Zkscan17 A G 11: 59,487,251 C369R probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTAAGTCCTTGAAACTTGCAG -3'
(R):5'- CCATATTTTCCCAGAATTTGGCAAC -3'

Sequencing Primer
(F):5'- GTCCTTGAAACTTGCAGGCCTAAC -3'
(R):5'- TGGCAACATATGAAGTCCATGTG -3'
Posted On2015-01-11