Incidental Mutation 'R3003:Slitrk5'
ID257374
Institutional Source Beutler Lab
Gene Symbol Slitrk5
Ensembl Gene ENSMUSG00000033214
Gene NameSLIT and NTRK-like family, member 5
Synonyms2610019D03Rik
MMRRC Submission 040532-MU
Accession Numbers

Ncbi RefSeq: NM_198865.1; MGI:2679448

Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R3003 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location111675097-111683141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111679582 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 213 (K213E)
Ref Sequence ENSEMBL: ENSMUSP00000041499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]
Predicted Effect probably damaging
Transcript: ENSMUST00000042767
AA Change: K213E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214
AA Change: K213E

DomainStartEndE-ValueType
Blast:LRRNT 47 85 3e-18 BLAST
low complexity region 86 96 N/A INTRINSIC
LRR 108 127 2.76e2 SMART
LRR_TYP 128 151 1.67e-2 SMART
LRR 152 175 2.67e-1 SMART
LRR 176 199 1.08e-1 SMART
LRR 202 223 7.38e1 SMART
LRRCT 235 285 2.13e-5 SMART
low complexity region 308 323 N/A INTRINSIC
LRRNT 373 410 9.53e-2 SMART
LRR 433 455 1.45e1 SMART
LRR_TYP 456 479 4.94e-5 SMART
LRR_TYP 480 503 7.78e-3 SMART
LRR_TYP 504 527 2.43e-4 SMART
LRR 528 551 1.86e2 SMART
LRRCT 563 613 3.59e-3 SMART
low complexity region 618 632 N/A INTRINSIC
transmembrane domain 666 688 N/A INTRINSIC
low complexity region 794 816 N/A INTRINSIC
low complexity region 818 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227891
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype Strain: 4459459
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,436,529 V568A probably damaging Het
Acd C T 8: 105,700,281 probably null Het
Acly T C 11: 100,504,227 K469E possibly damaging Het
Adh6b G T 3: 138,357,771 L248F possibly damaging Het
Arhgap8 G T 15: 84,771,830 C344F probably damaging Het
Atg9b G T 5: 24,391,219 D192E probably damaging Het
Ccdc180 A G 4: 45,899,988 D182G probably benign Het
Cep112 A G 11: 108,440,503 E178G probably damaging Het
Clptm1l C T 13: 73,617,756 T471I possibly damaging Het
Csmd1 A G 8: 16,196,170 F1072L probably damaging Het
Eprs T C 1: 185,424,391 probably null Het
Il27ra G T 8: 84,032,031 S499* probably null Het
Klk11 T C 7: 43,776,995 I51T probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mprip A G 11: 59,727,555 T91A possibly damaging Het
Pfpl T C 19: 12,430,326 I647T possibly damaging Het
Plxnc1 A T 10: 94,793,218 F1565I probably damaging Het
Rnf17 T C 14: 56,500,547 W1262R probably damaging Het
Rptor G A 11: 119,872,371 R927Q possibly damaging Het
Smarcd1 C A 15: 99,712,184 P432Q probably damaging Het
Stat4 A G 1: 52,102,986 D664G probably damaging Het
Suz12 T A 11: 80,019,761 W313R probably damaging Het
Sycp2 T C 2: 178,358,123 Y1020C probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem81 A G 1: 132,508,014 N186S probably benign Het
Vmn2r98 A G 17: 19,065,863 M208V probably benign Het
Zcchc11 G A 4: 108,512,928 E714K probably damaging Het
Other mutations in Slitrk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Slitrk5 APN 14 111680665 missense probably benign 0.05
IGL01624:Slitrk5 APN 14 111681094 missense probably damaging 1.00
IGL01680:Slitrk5 APN 14 111679000 missense probably benign 0.23
IGL03234:Slitrk5 APN 14 111679285 missense probably benign 0.00
P0019:Slitrk5 UTSW 14 111680594 missense possibly damaging 0.88
R0323:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R0334:Slitrk5 UTSW 14 111680824 missense probably benign
R0392:Slitrk5 UTSW 14 111679033 missense probably benign 0.06
R0659:Slitrk5 UTSW 14 111680689 missense probably benign 0.00
R1344:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R1754:Slitrk5 UTSW 14 111680519 missense probably damaging 1.00
R1983:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R2070:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R2071:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R3001:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3002:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3885:Slitrk5 UTSW 14 111679797 nonsense probably null
R3886:Slitrk5 UTSW 14 111679797 nonsense probably null
R3888:Slitrk5 UTSW 14 111679797 nonsense probably null
R4962:Slitrk5 UTSW 14 111681247 missense probably benign 0.02
R4999:Slitrk5 UTSW 14 111680216 missense probably damaging 0.99
R5036:Slitrk5 UTSW 14 111680884 missense possibly damaging 0.87
R5190:Slitrk5 UTSW 14 111679420 missense probably damaging 1.00
R5237:Slitrk5 UTSW 14 111681686 missense possibly damaging 0.94
R5669:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R5793:Slitrk5 UTSW 14 111679913 missense probably damaging 1.00
R5839:Slitrk5 UTSW 14 111679598 missense probably benign 0.00
R6083:Slitrk5 UTSW 14 111681725 missense probably benign 0.01
R6224:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6225:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6230:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6337:Slitrk5 UTSW 14 111680252 missense probably damaging 0.96
R6666:Slitrk5 UTSW 14 111680102 missense probably damaging 0.96
R6818:Slitrk5 UTSW 14 111680294 missense probably benign 0.32
R6895:Slitrk5 UTSW 14 111681653 missense probably damaging 1.00
R7094:Slitrk5 UTSW 14 111680836 missense probably benign 0.02
R7385:Slitrk5 UTSW 14 111680699 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AACTTCTGCGAGATGATACCTTTC -3'
(R):5'- AAATCCCTGCCGTGTAGACG -3'

Sequencing Primer
(F):5'- TGGCTTGGAGAACTTAGAATACCTGC -3'
(R):5'- ACGGAAGGGGGTCTCAC -3'
Posted On2015-01-11