Incidental Mutation 'R3004:Slco1c1'
ID257391
Institutional Source Beutler Lab
Gene Symbol Slco1c1
Ensembl Gene ENSMUSG00000030235
Gene Namesolute carrier organic anion transporter family, member 1c1
SynonymsSlc21a14, OATP-F
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141524368-141570177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 141532654 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 48 (A48S)
Ref Sequence ENSEMBL: ENSMUSP00000144889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032362] [ENSMUST00000135562] [ENSMUST00000203140] [ENSMUST00000204998] [ENSMUST00000205214]
Predicted Effect probably benign
Transcript: ENSMUST00000032362
AA Change: A48S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032362
Gene: ENSMUSG00000030235
AA Change: A48S

DomainStartEndE-ValueType
low complexity region 134 148 N/A INTRINSIC
low complexity region 152 168 N/A INTRINSIC
Pfam:MFS_1 181 464 1.1e-19 PFAM
KAZAL 478 518 1.21e0 SMART
transmembrane domain 644 666 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111837
AA Change: A49S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107468
Gene: ENSMUSG00000030235
AA Change: A49S

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 153 169 N/A INTRINSIC
Pfam:MFS_1 182 465 3.8e-18 PFAM
KAZAL 479 519 7.8e-3 SMART
transmembrane domain 559 581 N/A INTRINSIC
transmembrane domain 594 616 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135562
AA Change: A48S

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138093
Gene: ENSMUSG00000030235
AA Change: A48S

DomainStartEndE-ValueType
Pfam:OATP 42 469 2.1e-135 PFAM
Pfam:Sugar_tr 175 460 2.9e-7 PFAM
Pfam:MFS_1 181 463 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203140
SMART Domains Protein: ENSMUSP00000145058
Gene: ENSMUSG00000030235

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
Pfam:MFS_1 63 346 2e-18 PFAM
KAZAL 360 400 7.8e-3 SMART
transmembrane domain 437 459 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204998
Predicted Effect probably damaging
Transcript: ENSMUST00000205214
AA Change: A48S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144889
Gene: ENSMUSG00000030235
AA Change: A48S

DomainStartEndE-ValueType
Pfam:OATP 44 176 1.3e-35 PFAM
Pfam:MFS_1 169 415 1.1e-10 PFAM
KAZAL 429 469 7.8e-3 SMART
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of thyroid hormones in brain tissues. This protein has particularly high affinity for the thyroid hormones thyroxine, tri-iodothyronine and reverse tri-iodothyronine. Polymorphisms in the gene encoding this protein may be associated with fatigue and depression in patients suffering from hyperthyroidism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thyroxine and triiodothyronine levels in the forebrain, in the absence of overt growth, reproductive or neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in Slco1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Slco1c1 APN 6 141569482 missense probably benign 0.00
IGL00766:Slco1c1 APN 6 141547883 missense probably damaging 1.00
IGL00825:Slco1c1 APN 6 141542142 missense probably damaging 1.00
IGL01380:Slco1c1 APN 6 141540051 missense probably damaging 1.00
IGL01583:Slco1c1 APN 6 141540067 missense probably damaging 1.00
IGL01877:Slco1c1 APN 6 141555153 missense probably damaging 0.98
IGL02601:Slco1c1 APN 6 141544829 missense probably damaging 1.00
IGL02852:Slco1c1 APN 6 141547824 nonsense probably null
IGL03058:Slco1c1 APN 6 141563187 missense probably benign 0.44
IGL03102:Slco1c1 APN 6 141544827 missense possibly damaging 0.63
R0101:Slco1c1 UTSW 6 141531510 missense probably damaging 0.99
R0326:Slco1c1 UTSW 6 141559773 missense probably benign 0.45
R0755:Slco1c1 UTSW 6 141531532 missense probably damaging 0.99
R1335:Slco1c1 UTSW 6 141542127 missense probably damaging 1.00
R2011:Slco1c1 UTSW 6 141555107 missense probably benign 0.00
R2084:Slco1c1 UTSW 6 141559852 nonsense probably null
R2163:Slco1c1 UTSW 6 141559752 missense probably benign 0.25
R2190:Slco1c1 UTSW 6 141563167 missense probably benign 0.02
R2248:Slco1c1 UTSW 6 141546689 missense probably damaging 1.00
R2876:Slco1c1 UTSW 6 141559856 missense probably damaging 1.00
R3196:Slco1c1 UTSW 6 141531448 splice site probably null
R4444:Slco1c1 UTSW 6 141546691 missense possibly damaging 0.96
R4529:Slco1c1 UTSW 6 141555181 missense probably damaging 1.00
R4743:Slco1c1 UTSW 6 141564516 missense probably damaging 0.98
R5261:Slco1c1 UTSW 6 141546776 missense probably damaging 1.00
R5451:Slco1c1 UTSW 6 141559878 missense probably benign 0.04
R5558:Slco1c1 UTSW 6 141567496 missense probably damaging 0.97
R5813:Slco1c1 UTSW 6 141542203 missense probably damaging 1.00
R5836:Slco1c1 UTSW 6 141569314 missense probably damaging 1.00
R6084:Slco1c1 UTSW 6 141546770 missense probably benign 0.02
R6434:Slco1c1 UTSW 6 141547850 missense probably damaging 1.00
R6544:Slco1c1 UTSW 6 141531444 unclassified probably null
R6766:Slco1c1 UTSW 6 141547809 missense possibly damaging 0.49
R6865:Slco1c1 UTSW 6 141540052 missense probably damaging 1.00
R7050:Slco1c1 UTSW 6 141547926 missense probably damaging 1.00
R7164:Slco1c1 UTSW 6 141542129 nonsense probably null
R7255:Slco1c1 UTSW 6 141569325 missense probably benign 0.07
R7362:Slco1c1 UTSW 6 141569463 missense probably benign 0.00
X0061:Slco1c1 UTSW 6 141532739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTGAGCTCCAACCGTGC -3'
(R):5'- CTCAGCAGACAATGATGGATGG -3'

Sequencing Primer
(F):5'- CTTGGGTCAAGCCATCAATG -3'
(R):5'- CTCAGGAGAAAGACCTTGGGC -3'
Posted On2015-01-11