Incidental Mutation 'R3004:Slfn9'
ID257397
Institutional Source Beutler Lab
Gene Symbol Slfn9
Ensembl Gene ENSMUSG00000069793
Gene Nameschlafen 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82978390-82991830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82981764 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 715 (S715R)
Ref Sequence ENSEMBL: ENSMUSP00000090515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038211] [ENSMUST00000092840] [ENSMUST00000138797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038211
AA Change: S715R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044435
Gene: ENSMUSG00000069793
AA Change: S715R

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AlbA_2 205 343 2.3e-17 PFAM
Pfam:DUF2075 592 766 9.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092840
AA Change: S715R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090515
Gene: ENSMUSG00000069793
AA Change: S715R

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 1.6e-18 PFAM
Pfam:DUF2075 592 766 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138797
SMART Domains Protein: ENSMUSP00000115273
Gene: ENSMUSG00000069793

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 3.8e-19 PFAM
Pfam:DUF2075 592 642 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183379
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in Slfn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slfn9 APN 11 82981371 nonsense probably null
IGL01340:Slfn9 APN 11 82981751 missense probably benign 0.29
IGL01543:Slfn9 APN 11 82987949 missense probably benign
IGL01735:Slfn9 APN 11 82982332 missense probably damaging 1.00
IGL01778:Slfn9 APN 11 82987374 missense probably damaging 0.98
IGL01863:Slfn9 APN 11 82981325 missense probably benign 0.27
IGL01997:Slfn9 APN 11 82987677 missense possibly damaging 0.80
IGL02380:Slfn9 APN 11 82981220 missense probably benign 0.23
IGL02993:Slfn9 APN 11 82981196 missense probably benign 0.18
R1463:Slfn9 UTSW 11 82981698 missense possibly damaging 0.78
R1687:Slfn9 UTSW 11 82982157 missense probably damaging 0.99
R1786:Slfn9 UTSW 11 82981307 missense probably damaging 0.99
R1796:Slfn9 UTSW 11 82981955 missense probably benign 0.00
R1870:Slfn9 UTSW 11 82981576 missense probably benign
R1871:Slfn9 UTSW 11 82981576 missense probably benign
R2004:Slfn9 UTSW 11 82988201 missense probably benign 0.25
R2024:Slfn9 UTSW 11 82981681 missense probably damaging 1.00
R2106:Slfn9 UTSW 11 82987680 missense possibly damaging 0.89
R2140:Slfn9 UTSW 11 82984655 missense possibly damaging 0.76
R4293:Slfn9 UTSW 11 82982508 missense probably benign 0.01
R4927:Slfn9 UTSW 11 82981390 missense possibly damaging 0.47
R4950:Slfn9 UTSW 11 82981904 missense probably benign
R5471:Slfn9 UTSW 11 82982787 missense possibly damaging 0.85
R5543:Slfn9 UTSW 11 82982381 missense probably damaging 1.00
R5576:Slfn9 UTSW 11 82981432 missense probably benign
R5996:Slfn9 UTSW 11 82987484 missense possibly damaging 0.67
R7272:Slfn9 UTSW 11 82981561 missense probably benign 0.36
R7421:Slfn9 UTSW 11 82981371 nonsense probably null
R7421:Slfn9 UTSW 11 82987736 missense probably damaging 0.96
R7498:Slfn9 UTSW 11 82982187 missense not run
Predicted Primers PCR Primer
(F):5'- ATCTCATAGGTGCCTGATACAC -3'
(R):5'- CAGTGACCCGGAAAACCTTC -3'

Sequencing Primer
(F):5'- CCTTGGGACCACTTAAATTCATGGAG -3'
(R):5'- ATTTCCGCACTGAGGATG -3'
Posted On2015-01-11