Mutagenetix > Incidental Mutation

Incidental Mutation 'R3005:Csnk1e'

257424

Institutional Source

Beutler Lab

Gene Symbol

Csnk1e

Ensembl Gene

ENSMUSG00000022433

Gene Name

casein kinase 1, epsilon

Synonyms

tau, CKIepsilon, CK1epsilon, CKI epsilon, KC1epsilon

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79302056-79339767 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79323005 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 15 (I15V)

Ref Sequence

ENSEMBL: ENSMUSP00000155731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117786] [ENSMUST00000120859] [ENSMUST00000122044] [ENSMUST00000135519] [ENSMUST00000144790] [ENSMUST00000156043] [ENSMUST00000230599] [ENSMUST00000230942]

AlphaFold

Q9JMK2

Predicted Effect

probably benign
Transcript: ENSMUST00000117786
AA Change: I15V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113341
Gene: ENSMUSG00000022433
AA Change: I15V

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	9	273	8.7e-18	PFAM
Pfam:Pkinase	9	277	5.2e-28	PFAM
low complexity region	306	316	N/A	INTRINSIC
low complexity region	329	338	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120859
AA Change: I15V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113975
Gene: ENSMUSG00000022433
AA Change: I15V

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	9	273	9.8e-18	PFAM
Pfam:Pkinase	9	280	7e-40	PFAM
low complexity region	306	316	N/A	INTRINSIC
low complexity region	329	338	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122044
AA Change: I15V

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000113096
Gene: ENSMUSG00000022433
AA Change: I15V

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	9	273	7.9e-18	PFAM
Pfam:Pkinase	9	280	5.7e-40	PFAM
low complexity region	309	324	N/A	INTRINSIC
low complexity region	345	350	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135519
AA Change: I15V

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000122135
Gene: ENSMUSG00000022433
AA Change: I15V

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	118	1.5e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144790
AA Change: I15V

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000115637
Gene: ENSMUSG00000022433
AA Change: I15V

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	141	9.3e-24	PFAM
Pfam:Pkinase_Tyr	9	141	5.6e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156043
AA Change: I15V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000116593
Gene: ENSMUSG00000022433
AA Change: I15V

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	60	1.4e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000230599
AA Change: I15V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000230942
AA Change: I15V

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit disruptions in circadian rhythms. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cep162	C	A	9: 87,114,113 (GRCm39)	V320L	probably benign	Het
Cnga1	T	A	5: 72,762,450 (GRCm39)	I355F	probably damaging	Het
Dele1	T	A	18: 38,393,012 (GRCm39)	N405K	possibly damaging	Het
Exosc8	T	C	3: 54,639,568 (GRCm39)		probably null	Het
Garre1	T	C	7: 33,984,209 (GRCm39)	E138G	probably damaging	Het
Gstm3	G	T	3: 107,874,923 (GRCm39)	Q110K	probably benign	Het
Hace1	G	A	10: 45,524,959 (GRCm39)	G242R	probably damaging	Het
Lcn6	T	A	2: 25,567,261 (GRCm39)		probably null	Het
Msh6	A	G	17: 88,295,713 (GRCm39)	E1088G	probably benign	Het
Nlrp4c	G	A	7: 6,068,524 (GRCm39)	V142M	probably benign	Het
Nup50	G	A	15: 84,813,661 (GRCm39)		probably null	Het
Or51g2	C	T	7: 102,622,465 (GRCm39)	V245I	possibly damaging	Het
Ppp2r5a	A	T	1: 191,091,173 (GRCm39)	F218Y	probably damaging	Het
Ptov1	T	C	7: 44,513,886 (GRCm39)	N52S	probably damaging	Het
Rif1	G	A	2: 51,972,776 (GRCm39)	A303T	probably damaging	Het
Ror1	T	A	4: 100,298,961 (GRCm39)	V778E	probably damaging	Het
Tcaf3	A	T	6: 42,570,978 (GRCm39)	L258H	probably damaging	Het
Utp20	C	A	10: 88,613,317 (GRCm39)	K1321N	probably damaging	Het
Vmn2r54	T	A	7: 12,349,221 (GRCm39)	Q787L	probably benign	Het

Other mutations in Csnk1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0624:Csnk1e	UTSW	15	79,304,098 (GRCm39)	unclassified	probably benign
R1281:Csnk1e	UTSW	15	79,304,841 (GRCm39)	missense	possibly damaging	0.80
R1618:Csnk1e	UTSW	15	79,309,050 (GRCm39)	missense	probably benign	0.02
R4241:Csnk1e	UTSW	15	79,309,095 (GRCm39)	missense	probably damaging	1.00
R4242:Csnk1e	UTSW	15	79,309,095 (GRCm39)	missense	probably damaging	1.00
R4276:Csnk1e	UTSW	15	79,313,967 (GRCm39)	missense	probably damaging	1.00
R4438:Csnk1e	UTSW	15	79,305,129 (GRCm39)	missense	probably benign	0.08
R4994:Csnk1e	UTSW	15	79,309,129 (GRCm39)	missense	probably damaging	1.00
R5071:Csnk1e	UTSW	15	79,305,072 (GRCm39)	nonsense	probably null
R7072:Csnk1e	UTSW	15	79,322,967 (GRCm39)	splice site	probably null
R7553:Csnk1e	UTSW	15	79,310,566 (GRCm39)	missense	probably damaging	1.00
R8379:Csnk1e	UTSW	15	79,304,882 (GRCm39)	missense	possibly damaging	0.88
R8721:Csnk1e	UTSW	15	79,314,015 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGCTGTGAAAGAAGACATTCCCC -3'
(R):5'- AGCTAAGTGAAGCCAGATTGC -3'

Sequencing Primer
(F):5'- GAGCTTCCTTCTGGATCCGG -3'
(R):5'- AGCCAGATTGCTTCTCAGACAGTG -3'

Posted On

2015-01-11