Incidental Mutation 'R3005:0610009O20Rik'
List |< first << previous [record 20 of 386652] next >> last >|
ID257428
Institutional Source Beutler Lab
Gene Symbol 0610009O20Rik
Ensembl Gene ENSMUSG00000024442
Gene NameRIKEN cDNA 0610009O20 gene
Synonyms
Accession Numbers
Stock #R3005 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location38250249-38262629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38259959 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 405 (N405K)
Ref Sequence ENSEMBL: ENSMUSP00000025314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025314
AA Change: N405K

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025314
Gene: ENSMUSG00000024442
AA Change: N405K

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
low complexity region 127 140 N/A INTRINSIC
SEL1 244 277 1.53e2 SMART
SEL1 278 313 2.8e-9 SMART
SEL1 314 351 3.3e1 SMART
SEL1 352 385 1.31e0 SMART
SEL1 386 421 1.67e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,284,784 E138G probably damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Csnk1e T C 15: 79,438,805 I15V probably benign Het
Exosc8 T C 3: 54,732,147 probably null Het
Gstm3 G T 3: 107,967,607 Q110K probably benign Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Lama1 A G 17: 67,748,190 probably benign Het
Lcn6 T A 2: 25,677,249 probably null Het
Msh6 A G 17: 87,988,285 E1088G possibly damaging Het
Mycbp2 G T 14: 103,135,029 probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Nup50 G A 15: 84,929,460 probably null Het
Nup54 A G 5: 92,431,027 probably benign Het
Olfr577 C T 7: 102,973,258 V245I possibly damaging Het
Ppp2r5a A T 1: 191,358,976 F218Y probably damaging Het
Ptov1 T C 7: 44,864,462 N321S possibly damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Setd8 T C 5: 124,440,023 probably benign Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N possibly damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in 0610009O20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:0610009O20Rik APN 18 38252860 missense probably damaging 1.00
IGL02456:0610009O20Rik APN 18 38261124 missense probably damaging 1.00
R0134:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0225:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0511:0610009O20Rik UTSW 18 38254071 critical splice donor site probably null
R0560:0610009O20Rik UTSW 18 38254498 missense probably damaging 1.00
R1899:0610009O20Rik UTSW 18 38258342 missense probably benign 0.08
R3552:0610009O20Rik UTSW 18 38258365 splice site probably benign
R4418:0610009O20Rik UTSW 18 38261287 unclassified probably null
X0067:0610009O20Rik UTSW 18 38258023 splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GCGTTTCATGATCAAGGAGC -3'
(R):5'- ACTCTGAAAGCTGGCCTTCTAAC -3'

Sequencing Primer
(F):5'- TTCATGATCAAGGAGCTTGGAATG -3'
(R):5'- GAAAGCTGGCCTTCTAACTCCTG -3'
Posted OnJan 11, 2015