Incidental Mutation 'R3011:Gm14403'
ID257499
Institutional Source Beutler Lab
Gene Symbol Gm14403
Ensembl Gene ENSMUSG00000094786
Gene Namepredicted gene 14403
Synonyms
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R3011 (G1)
Quality Score140
Status Not validated
Chromosome2
Chromosomal Location177498215-177509763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 177508993 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 244 (D244G)
Ref Sequence ENSEMBL: ENSMUSP00000104575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108940] [ENSMUST00000108947]
Predicted Effect probably benign
Transcript: ENSMUST00000108940
SMART Domains Protein: ENSMUSP00000104568
Gene: ENSMUSG00000094786

DomainStartEndE-ValueType
internal_repeat_1 1 73 1.34e-11 PROSPERO
internal_repeat_1 169 241 1.34e-11 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000108947
AA Change: D244G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104575
Gene: ENSMUSG00000094786
AA Change: D244G

DomainStartEndE-ValueType
KRAB 4 66 4.86e-13 SMART
ZnF_C2H2 76 97 2.31e2 SMART
ZnF_C2H2 103 125 1.2e-3 SMART
ZnF_C2H2 131 153 1.18e-2 SMART
ZnF_C2H2 159 179 4.57e0 SMART
ZnF_C2H2 187 209 5.59e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 1.18e-2 SMART
ZnF_C2H2 271 293 8.6e-5 SMART
ZnF_C2H2 299 321 3.16e-3 SMART
ZnF_C2H2 327 349 1.84e-4 SMART
ZnF_C2H2 355 377 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142549
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Gm14403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Gm14403 APN 2 177507256 missense probably damaging 0.99
IGL02660:Gm14403 APN 2 177509464 missense probably damaging 1.00
R0492:Gm14403 UTSW 2 177508566 missense probably benign 0.09
R0932:Gm14403 UTSW 2 177507017 missense probably benign 0.01
R0975:Gm14403 UTSW 2 177509424 missense probably damaging 1.00
R1468:Gm14403 UTSW 2 177507231 splice site probably benign
R1853:Gm14403 UTSW 2 177509139 missense probably damaging 1.00
R3803:Gm14403 UTSW 2 177508776 missense probably benign 0.04
R4589:Gm14403 UTSW 2 177508635 missense probably benign 0.29
R4805:Gm14403 UTSW 2 177508699 missense probably damaging 0.97
R5085:Gm14403 UTSW 2 177508489 missense probably benign 0.04
R5311:Gm14403 UTSW 2 177509655 unclassified probably benign
R5425:Gm14403 UTSW 2 177509655 unclassified probably benign
R5643:Gm14403 UTSW 2 177507261 missense possibly damaging 0.87
R5644:Gm14403 UTSW 2 177507261 missense possibly damaging 0.87
R5739:Gm14403 UTSW 2 177509247 missense probably damaging 1.00
R5982:Gm14403 UTSW 2 177508552 missense probably damaging 0.98
R6197:Gm14403 UTSW 2 177509655 unclassified probably benign
R6198:Gm14403 UTSW 2 177509655 unclassified probably benign
R6892:Gm14403 UTSW 2 177509247 missense probably damaging 1.00
R7090:Gm14403 UTSW 2 177509321 missense possibly damaging 0.87
R7168:Gm14403 UTSW 2 177509525 missense probably damaging 0.96
R7510:Gm14403 UTSW 2 177508610 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTTCTGCAGAGCAACCCT -3'
(R):5'- GCAAAGGCTTTACCACATTGGT -3'

Sequencing Primer
(F):5'- AGCCTTTGCAAGAAGCTGTC -3'
(R):5'- CCACATTGGTTACATTCATAGGG -3'
Posted On2015-01-11