Incidental Mutation 'R3011:Olfr70'
ID257502
Institutional Source Beutler Lab
Gene Symbol Olfr70
Ensembl Gene ENSMUSG00000050215
Gene Nameolfactory receptor 70
SynonymsMOR262-10, GA_x6K02T2N78B-16239704-16240654, mOR6
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43694784-43700807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43696624 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 183 (A183E)
Ref Sequence ENSEMBL: ENSMUSP00000060748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055545] [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000167153]
Predicted Effect probably damaging
Transcript: ENSMUST00000055545
AA Change: A183E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060748
Gene: ENSMUSG00000050215
AA Change: A183E

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 9.6e-51 PFAM
Pfam:7tm_1 41 289 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107865
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107866
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158322
Predicted Effect probably benign
Transcript: ENSMUST00000167153
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Meta Mutation Damage Score 0.0392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Olfr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0111:Olfr70 UTSW 4 43696648 missense probably damaging 0.99
R0501:Olfr70 UTSW 4 43697079 missense probably damaging 1.00
R0973:Olfr70 UTSW 4 43696706 missense probably damaging 1.00
R0973:Olfr70 UTSW 4 43696706 missense probably damaging 1.00
R0974:Olfr70 UTSW 4 43696706 missense probably damaging 1.00
R1413:Olfr70 UTSW 4 43697011 missense possibly damaging 0.87
R1452:Olfr70 UTSW 4 43696823 missense probably benign 0.12
R1574:Olfr70 UTSW 4 43697134 missense possibly damaging 0.85
R1574:Olfr70 UTSW 4 43697134 missense possibly damaging 0.85
R2159:Olfr70 UTSW 4 43697110 missense probably benign 0.01
R5493:Olfr70 UTSW 4 43696225 missense possibly damaging 0.67
R5651:Olfr70 UTSW 4 43696636 missense probably damaging 1.00
R6938:Olfr70 UTSW 4 43696286 missense probably damaging 1.00
R6976:Olfr70 UTSW 4 43697170 start codon destroyed probably null 0.99
R7315:Olfr70 UTSW 4 43696961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGTTCCATAGAAAATCACCACC -3'
(R):5'- TGGCTGTGATGGCATACGAC -3'

Sequencing Primer
(F):5'- TAGAAAATCACCACCACCGTGAG -3'
(R):5'- TGTGATGGCATACGACCGGTAC -3'
Posted On2015-01-11