Incidental Mutation 'R3011:4930432K21Rik'
ID257508
Institutional Source Beutler Lab
Gene Symbol 4930432K21Rik
Ensembl Gene ENSMUSG00000008129
Gene NameRIKEN cDNA 4930432K21 gene
Synonyms
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84148025-84172590 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 84166910 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 235 (Y235*)
Ref Sequence ENSEMBL: ENSMUSP00000113651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093375] [ENSMUST00000118856] [ENSMUST00000143833]
Predicted Effect probably null
Transcript: ENSMUST00000093375
AA Change: Y200*
SMART Domains Protein: ENSMUSP00000091067
Gene: ENSMUSG00000008129
AA Change: Y200*

DomainStartEndE-ValueType
low complexity region 226 241 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118856
AA Change: Y235*
SMART Domains Protein: ENSMUSP00000113651
Gene: ENSMUSG00000008129
AA Change: Y235*

DomainStartEndE-ValueType
Pfam:DUF4671 1 193 2.1e-62 PFAM
Pfam:DUF4671 181 600 7.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143833
Meta Mutation Damage Score 0.6592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in 4930432K21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:4930432K21Rik APN 8 84166771 missense probably damaging 0.99
IGL00964:4930432K21Rik APN 8 84166714 missense probably benign 0.07
IGL01826:4930432K21Rik APN 8 84166672 missense probably benign 0.03
IGL02445:4930432K21Rik APN 8 84159508 missense probably benign 0.13
R0113:4930432K21Rik UTSW 8 84167242 missense probably damaging 1.00
R1479:4930432K21Rik UTSW 8 84162397 missense possibly damaging 0.59
R1590:4930432K21Rik UTSW 8 84167086 missense probably benign 0.28
R4357:4930432K21Rik UTSW 8 84159592 missense probably benign 0.25
R5642:4930432K21Rik UTSW 8 84167485 missense probably damaging 0.99
R5664:4930432K21Rik UTSW 8 84166659 missense probably benign 0.25
R5722:4930432K21Rik UTSW 8 84171844 missense probably damaging 0.96
R7031:4930432K21Rik UTSW 8 84166684 missense possibly damaging 0.83
R7224:4930432K21Rik UTSW 8 84172213 missense probably benign
R7303:4930432K21Rik UTSW 8 84161233 missense probably benign 0.38
R7459:4930432K21Rik UTSW 8 84167352 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAATGGTTTTGAGATGGCCAC -3'
(R):5'- TCAGGGATCTGCTCATCCAGAG -3'

Sequencing Primer
(F):5'- TTTGAGATGGCCACAGTTCAAGAC -3'
(R):5'- CACTCTGTTGCAGCACAGAG -3'
Posted On2015-01-11