Incidental Mutation 'R3011:Snx18'
ID257515
Institutional Source Beutler Lab
Gene Symbol Snx18
Ensembl Gene ENSMUSG00000042364
Gene Namesorting nexin 18
SynonymsSnag1
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location113592179-113618564 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 113616886 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 504 (Q504*)
Ref Sequence ENSEMBL: ENSMUSP00000104864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109241]
Predicted Effect probably null
Transcript: ENSMUST00000109241
AA Change: Q504*
SMART Domains Protein: ENSMUSP00000104864
Gene: ENSMUSG00000042364
AA Change: Q504*

DomainStartEndE-ValueType
SH3 3 60 1.04e-14 SMART
low complexity region 61 76 N/A INTRINSIC
low complexity region 82 105 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
PX 264 373 8.75e-22 SMART
Pfam:BAR_3_WASP_bdg 377 613 7.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224883
Meta Mutation Damage Score 0.644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a SH3 domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Snx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Snx18 APN 13 113617516 missense probably benign 0.13
IGL02068:Snx18 APN 13 113617065 missense probably damaging 1.00
IGL02195:Snx18 APN 13 113616840 missense probably damaging 0.99
IGL02541:Snx18 APN 13 113594766 missense probably damaging 0.98
R2419:Snx18 UTSW 13 113617219 missense possibly damaging 0.52
R2958:Snx18 UTSW 13 113616886 nonsense probably null
R3010:Snx18 UTSW 13 113616886 nonsense probably null
R4461:Snx18 UTSW 13 113617195 missense probably damaging 1.00
R4557:Snx18 UTSW 13 113617828 missense probably damaging 1.00
R4732:Snx18 UTSW 13 113617774 missense probably benign 0.04
R4733:Snx18 UTSW 13 113617774 missense probably benign 0.04
R5308:Snx18 UTSW 13 113616847 nonsense probably null
R6157:Snx18 UTSW 13 113617189 missense probably damaging 1.00
R6995:Snx18 UTSW 13 113594729 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAACCCGGCAGTGGTATG -3'
(R):5'- AGATGGACGACAGTGCGTTG -3'

Sequencing Primer
(F):5'- AGTGGTATGCCTATCCAAGTCAC -3'
(R):5'- CAACGAGTTTGCGCGCAAG -3'
Posted On2015-01-11