Incidental Mutation 'R3011:Gm5414'
ID257517
Institutional Source Beutler Lab
Gene Symbol Gm5414
Ensembl Gene ENSMUSG00000064232
Gene Namepredicted gene 5414
Synonyms
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101624028-101628188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101625612 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 312 (D312G)
Ref Sequence ENSEMBL: ENSMUSP00000059101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062879]
Predicted Effect probably damaging
Transcript: ENSMUST00000062879
AA Change: D312G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059101
Gene: ENSMUSG00000064232
AA Change: D312G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 3.3e-29 PFAM
Filament 151 464 1.4e-143 SMART
low complexity region 489 507 N/A INTRINSIC
low complexity region 511 549 N/A INTRINSIC
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Gm5414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Gm5414 APN 15 101628134 missense probably benign 0.00
IGL01774:Gm5414 APN 15 101626975 missense probably benign 0.13
IGL01939:Gm5414 APN 15 101625670 splice site probably benign
IGL02205:Gm5414 APN 15 101625869 missense probably benign 0.44
IGL02411:Gm5414 APN 15 101627834 missense probably benign 0.05
IGL02720:Gm5414 APN 15 101625555 missense probably damaging 1.00
IGL02900:Gm5414 APN 15 101627807 missense probably damaging 0.99
IGL03283:Gm5414 APN 15 101627087 missense probably damaging 1.00
PIT4480001:Gm5414 UTSW 15 101627746 missense probably damaging 1.00
PIT4504001:Gm5414 UTSW 15 101625823 missense probably damaging 0.98
R1905:Gm5414 UTSW 15 101624640 missense probably damaging 1.00
R2070:Gm5414 UTSW 15 101628060 missense possibly damaging 0.52
R3033:Gm5414 UTSW 15 101624609 missense probably damaging 1.00
R4074:Gm5414 UTSW 15 101625553 missense probably benign
R4257:Gm5414 UTSW 15 101624672 missense probably damaging 1.00
R4396:Gm5414 UTSW 15 101625666 missense probably damaging 1.00
R4648:Gm5414 UTSW 15 101628108 missense possibly damaging 0.72
R4912:Gm5414 UTSW 15 101625010 missense possibly damaging 0.46
R5095:Gm5414 UTSW 15 101624038 missense probably benign 0.01
R5135:Gm5414 UTSW 15 101627768 missense probably damaging 0.97
R5177:Gm5414 UTSW 15 101625817 missense possibly damaging 0.91
R5330:Gm5414 UTSW 15 101624664 missense probably damaging 1.00
R5331:Gm5414 UTSW 15 101624664 missense probably damaging 1.00
R5432:Gm5414 UTSW 15 101624634 missense probably damaging 1.00
R5521:Gm5414 UTSW 15 101627987 missense probably benign 0.33
R5623:Gm5414 UTSW 15 101625811 missense probably damaging 1.00
R6781:Gm5414 UTSW 15 101625661 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAGACTCATGGAGTTCAGGG -3'
(R):5'- GCCAAGGTCCACAGTTTGATAG -3'

Sequencing Primer
(F):5'- CATGGAGTTCAGGGTGGGTCC -3'
(R):5'- GGTCCACAGTTTGATAGATGAGATC -3'
Posted On2015-01-11