Incidental Mutation 'R3011:Olfr190'
ID257520
Institutional Source Beutler Lab
Gene Symbol Olfr190
Ensembl Gene ENSMUSG00000064006
Gene Nameolfactory receptor 190
SynonymsMOR183-4, GA_x54KRFPKG5P-55303207-55302284
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59067140-59078005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59074987 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 31 (V31A)
Ref Sequence ENSEMBL: ENSMUSP00000148991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071243] [ENSMUST00000206214] [ENSMUST00000215687] [ENSMUST00000216495]
Predicted Effect probably benign
Transcript: ENSMUST00000071243
AA Change: V31A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000071224
Gene: ENSMUSG00000064006
AA Change: V31A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-46 PFAM
Pfam:7tm_1 39 288 2.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206214
AA Change: V31A
Predicted Effect probably benign
Transcript: ENSMUST00000215687
AA Change: V31A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000216495
AA Change: V31A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Olfr190
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr190 APN 16 59074689 nonsense probably null
IGL01011:Olfr190 APN 16 59074430 missense probably benign 0.10
IGL01453:Olfr190 APN 16 59074769 missense probably benign 0.00
IGL01978:Olfr190 APN 16 59074267 missense probably benign 0.33
IGL02348:Olfr190 APN 16 59074949 missense probably damaging 0.99
IGL02423:Olfr190 APN 16 59074267 missense probably benign 0.33
IGL02628:Olfr190 APN 16 59074792 missense probably benign 0.01
R0220:Olfr190 UTSW 16 59074732 missense probably damaging 1.00
R0471:Olfr190 UTSW 16 59074270 missense probably benign 0.01
R1697:Olfr190 UTSW 16 59074907 missense probably damaging 1.00
R3009:Olfr190 UTSW 16 59074987 missense probably benign 0.01
R3027:Olfr190 UTSW 16 59074967 missense probably benign 0.00
R4080:Olfr190 UTSW 16 59074256 missense probably damaging 0.96
R4482:Olfr190 UTSW 16 59074923 missense probably benign 0.02
R4895:Olfr190 UTSW 16 59074657 missense probably benign 0.09
R5409:Olfr190 UTSW 16 59074196 missense possibly damaging 0.94
R5825:Olfr190 UTSW 16 59074661 missense probably benign 0.01
R6146:Olfr190 UTSW 16 59074714 missense probably benign 0.05
R6249:Olfr190 UTSW 16 59074432 missense probably damaging 1.00
R6996:Olfr190 UTSW 16 59074192 missense probably benign 0.00
R7283:Olfr190 UTSW 16 59074192 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATTGTGTCATGCATTCAGAGTAGG -3'
(R):5'- ACATGGTATCAAATGTACTCTCCTG -3'

Sequencing Primer
(F):5'- GTGTCATGCATTCAGAGTAGGAAATC -3'
(R):5'- TCAGTGATTATCCATTGAGG -3'
Posted On2015-01-11