Incidental Mutation 'R3013:Wdr49'
ID257559
Institutional Source Beutler Lab
Gene Symbol Wdr49
Ensembl Gene ENSMUSG00000104301
Gene NameWD repeat domain 49
SynonymsEG213248
MMRRC Submission 040534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3013 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location75274988-75482156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75450847 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 260 (I260T)
Ref Sequence ENSEMBL: ENSMUSP00000144789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000193989] [ENSMUST00000203169] [ENSMUST00000204341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178270
AA Change: I197T

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137584
Gene: ENSMUSG00000095162
AA Change: I197T

DomainStartEndE-ValueType
WD40 73 113 3.18e1 SMART
WD40 115 161 2.74e2 SMART
WD40 249 290 7.92e1 SMART
WD40 295 333 1.99e0 SMART
WD40 337 376 3.05e-4 SMART
Blast:WD40 423 448 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193989
SMART Domains Protein: ENSMUSP00000144721
Gene: ENSMUSG00000104301

DomainStartEndE-ValueType
WD40 17 55 1.3e-2 SMART
WD40 59 98 2e-6 SMART
WD40 145 184 2.5e-2 SMART
WD40 187 228 3.6e-8 SMART
WD40 281 318 8.7e-6 SMART
WD40 365 412 2.2e-1 SMART
WD40 415 455 8.4e-4 SMART
WD40 471 512 3.1e-2 SMART
Blast:SERPIN 608 673 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000203169
AA Change: I260T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144789
Gene: ENSMUSG00000104301
AA Change: I260T

DomainStartEndE-ValueType
WD40 136 176 2e-1 SMART
WD40 178 224 1.8e0 SMART
WD40 312 353 5.1e-1 SMART
WD40 358 396 1.3e-2 SMART
WD40 400 439 2e-6 SMART
Blast:WD40 486 511 1e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000204341
AA Change: I197T

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145379
Gene: ENSMUSG00000104301
AA Change: I197T

DomainStartEndE-ValueType
WD40 73 113 3.18e1 SMART
WD40 115 161 2.74e2 SMART
WD40 249 290 7.92e1 SMART
WD40 295 333 1.99e0 SMART
WD40 337 376 3.05e-4 SMART
Blast:WD40 423 448 1e-7 BLAST
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family with nine WD repeats. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 C T 8: 123,484,677 R126W probably benign Het
Alg10b T A 15: 90,227,556 I201N possibly damaging Het
Arid2 T C 15: 96,361,936 S326P probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bpifb5 T C 2: 154,228,855 S189P possibly damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Ccdc57 A G 11: 120,861,199 V852A probably benign Het
Ces1e G A 8: 93,203,287 S455L probably benign Het
Cyp4f14 T C 17: 32,909,165 K292R probably benign Het
Dnah7b T C 1: 46,188,687 probably null Het
Eml5 T C 12: 98,880,808 probably null Het
Gm13119 T A 4: 144,362,455 D114E probably damaging Het
Gtf2i T C 5: 134,295,504 probably benign Het
Hip1 T A 5: 135,435,039 E37V possibly damaging Het
Hspbp1 G T 7: 4,663,484 T299K probably benign Het
Lrpprc T C 17: 84,767,069 D470G probably benign Het
Mkx A T 18: 6,936,929 I334N probably damaging Het
Obscn A T 11: 59,060,918 L4003Q probably damaging Het
Pcnx2 C A 8: 125,887,770 C314F probably benign Het
Prr5l A G 2: 101,734,705 F162S probably damaging Het
Rbfox2 T C 15: 77,132,920 T17A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A T 2: 112,640,281 F4610L probably damaging Het
Scp2 T A 4: 108,071,357 R379W probably damaging Het
Serpina3j A G 12: 104,319,707 T374A probably damaging Het
Smad4 T C 18: 73,648,904 Y429C probably damaging Het
Ttn T C 2: 76,734,681 T28401A probably damaging Het
Xirp1 T C 9: 120,019,785 T11A probably benign Het
Zfp235 A G 7: 24,140,732 D262G probably damaging Het
Other mutations in Wdr49
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0266:Wdr49 UTSW 3 75451796 missense possibly damaging 0.80
R0432:Wdr49 UTSW 3 75450022 missense possibly damaging 0.70
R0599:Wdr49 UTSW 3 75431076 splice site probably null
R0599:Wdr49 UTSW 3 75449890 splice site probably null
R0948:Wdr49 UTSW 3 75450851 missense probably benign 0.06
R1341:Wdr49 UTSW 3 75429333 missense probably damaging 1.00
R1526:Wdr49 UTSW 3 75396920 missense probably benign 0.03
R1593:Wdr49 UTSW 3 75396941 missense probably benign 0.00
R1603:Wdr49 UTSW 3 75396870 nonsense probably null
R1874:Wdr49 UTSW 3 75429347 missense probably damaging 1.00
R2986:Wdr49 UTSW 3 75382040 missense probably benign 0.11
R3025:Wdr49 UTSW 3 75333356 missense possibly damaging 0.94
R4027:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4029:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4030:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4031:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4578:Wdr49 UTSW 3 75335243 missense probably benign 0.00
R6024:Wdr49 UTSW 3 75301826 missense probably benign 0.02
R6141:Wdr49 UTSW 3 75323682 missense probably benign
R6172:Wdr49 UTSW 3 75298180 missense probably damaging 1.00
R6263:Wdr49 UTSW 3 75481517 missense possibly damaging 0.84
R6501:Wdr49 UTSW 3 75339458 missense probably benign 0.01
R6584:Wdr49 UTSW 3 75337758 missense probably benign 0.01
R6698:Wdr49 UTSW 3 75429366 missense probably benign 0.01
R6891:Wdr49 UTSW 3 75333283 synonymous probably null
R7202:Wdr49 UTSW 3 75333273 missense probably benign 0.11
R7214:Wdr49 UTSW 3 75358444 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTCTTAGCTCTCTAACAATGGAAATCC -3'
(R):5'- AGGGCTCTCAGAGAACTGTC -3'

Sequencing Primer
(F):5'- TCCCACAAATCAAAACAAGTACTTTG -3'
(R):5'- CACTAGATAGCAGTGGCT -3'
Posted On2015-01-11