Incidental Mutation 'R3013:Alg10b'
ID257577
Institutional Source Beutler Lab
Gene Symbol Alg10b
Ensembl Gene ENSMUSG00000075470
Gene Nameasparagine-linked glycosylation 10B (alpha-1,2-glucosyltransferase)
SynonymsDeaf1, LOC380959, nse5
MMRRC Submission 040534-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3013 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location90224311-90233471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90227556 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 201 (I201N)
Ref Sequence ENSEMBL: ENSMUSP00000097882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100309] [ENSMUST00000231200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100309
AA Change: I201N

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097882
Gene: ENSMUSG00000075470
AA Change: I201N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DIE2_ALG10 31 428 2.4e-133 PFAM
transmembrane domain 435 457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183650
Predicted Effect unknown
Transcript: ENSMUST00000231200
AA Change: H151Q
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated protein that adds the third glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation. That is, it transfers the terminal glucose from dolichyl phosphate glucose (Dol-P-Glc) onto the lipid-linked oligosaccharide Glc2Man9GlcNAc(2)-PP-Dol. The rat protein homolog was shown to specifically modulate the gating function of the rat neuronal ether-a-go-go (EAG) potassium ion channel. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit deafness associated with cochlear outer hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 C T 8: 123,484,677 R126W probably benign Het
Arid2 T C 15: 96,361,936 S326P probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bpifb5 T C 2: 154,228,855 S189P possibly damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Ccdc57 A G 11: 120,861,199 V852A probably benign Het
Ces1e G A 8: 93,203,287 S455L probably benign Het
Cyp4f14 T C 17: 32,909,165 K292R probably benign Het
Dnah7b T C 1: 46,188,687 probably null Het
Eml5 T C 12: 98,880,808 probably null Het
Gm13119 T A 4: 144,362,455 D114E probably damaging Het
Gtf2i T C 5: 134,295,504 probably benign Het
Hip1 T A 5: 135,435,039 E37V possibly damaging Het
Hspbp1 G T 7: 4,663,484 T299K probably benign Het
Lrpprc T C 17: 84,767,069 D470G probably benign Het
Mkx A T 18: 6,936,929 I334N probably damaging Het
Obscn A T 11: 59,060,918 L4003Q probably damaging Het
Pcnx2 C A 8: 125,887,770 C314F probably benign Het
Prr5l A G 2: 101,734,705 F162S probably damaging Het
Rbfox2 T C 15: 77,132,920 T17A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A T 2: 112,640,281 F4610L probably damaging Het
Scp2 T A 4: 108,071,357 R379W probably damaging Het
Serpina3j A G 12: 104,319,707 T374A probably damaging Het
Smad4 T C 18: 73,648,904 Y429C probably damaging Het
Ttn T C 2: 76,734,681 T28401A probably damaging Het
Wdr49 A G 3: 75,450,847 I260T probably damaging Het
Xirp1 T C 9: 120,019,785 T11A probably benign Het
Zfp235 A G 7: 24,140,732 D262G probably damaging Het
Other mutations in Alg10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Alg10b APN 15 90228389 utr 3 prime probably benign
IGL01472:Alg10b APN 15 90227697 missense possibly damaging 0.91
IGL02512:Alg10b APN 15 90227549 missense probably benign
IGL03402:Alg10b APN 15 90228329 nonsense probably null
R1148:Alg10b UTSW 15 90227865 missense possibly damaging 0.67
R1148:Alg10b UTSW 15 90227865 missense possibly damaging 0.67
R1384:Alg10b UTSW 15 90227582 missense possibly damaging 0.49
R1611:Alg10b UTSW 15 90225781 missense probably damaging 1.00
R2113:Alg10b UTSW 15 90225657 missense probably damaging 1.00
R3078:Alg10b UTSW 15 90227936 missense probably benign 0.42
R4629:Alg10b UTSW 15 90227745 missense probably benign 0.00
R4633:Alg10b UTSW 15 90228294 missense probably benign
R7096:Alg10b UTSW 15 90227361 missense probably benign 0.11
R7350:Alg10b UTSW 15 90227450 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGCAGTGTTTCCAACCCTC -3'
(R):5'- TGACTACTCCGGTCACCAAC -3'

Sequencing Primer
(F):5'- ATGGCAACCATAGGACCT -3'
(R):5'- CAGAAGCACGTAGGGCC -3'
Posted On2015-01-11