Mutagenetix > Incidental Mutation

Incidental Mutation 'R3013:Lrpprc'

257580

Institutional Source

Beutler Lab

Gene Symbol

Lrpprc

Ensembl Gene

ENSMUSG00000024120

Gene Name

leucine-rich PPR-motif containing

Synonyms

Lrp130, 3110001K13Rik

MMRRC Submission

040534-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3013 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85012675-85098214 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85074497 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 470 (D470G)

Ref Sequence

ENSEMBL: ENSMUSP00000107927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112308]

AlphaFold

Q6PB66

Predicted Effect

probably benign
Transcript: ENSMUST00000112308
AA Change: D470G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: D470G

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	32	50	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Pfam:PPR_3	196	228	9.1e-4	PFAM
Pfam:PPR	197	227	2.3e-4	PFAM
Pfam:PPR_3	231	264	7.9e-6	PFAM
Pfam:PPR	232	262	4e-4	PFAM
Pfam:PPR_3	266	297	9.7e-3	PFAM
internal_repeat_2	391	477	3.13e-7	PROSPERO
Pfam:PPR	750	778	3.4e-4	PFAM
low complexity region	1017	1028	N/A	INTRINSIC
internal_repeat_1	1042	1362	1.09e-11	PROSPERO
low complexity region	1366	1375	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161299

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161928

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l1	C	T	8: 124,211,416 (GRCm39)	R126W	probably benign	Het
Alg10b	T	A	15: 90,111,759 (GRCm39)	I201N	possibly damaging	Het
Arid2	T	C	15: 96,259,817 (GRCm39)	S326P	probably damaging	Het
Ash2l	T	C	8: 26,329,792 (GRCm39)	D122G	probably damaging	Het
Bpifb5	T	C	2: 154,070,775 (GRCm39)	S189P	possibly damaging	Het
Ccdc39	C	T	3: 33,868,817 (GRCm39)	R798Q	probably damaging	Het
Ccdc57	A	G	11: 120,752,025 (GRCm39)	V852A	probably benign	Het
Ces1e	G	A	8: 93,929,915 (GRCm39)	S455L	probably benign	Het
Cyp4f14	T	C	17: 33,128,139 (GRCm39)	K292R	probably benign	Het
Dnah7b	T	C	1: 46,227,847 (GRCm39)		probably null	Het
Eml5	T	C	12: 98,847,067 (GRCm39)		probably null	Het
Gtf2i	T	C	5: 134,324,358 (GRCm39)		probably benign	Het
Hip1	T	A	5: 135,463,893 (GRCm39)	E37V	possibly damaging	Het
Hspbp1	G	T	7: 4,666,483 (GRCm39)	T299K	probably benign	Het
Mkx	A	T	18: 6,936,929 (GRCm39)	I334N	probably damaging	Het
Obscn	A	T	11: 58,951,744 (GRCm39)	L4003Q	probably damaging	Het
Pcnx2	C	A	8: 126,614,509 (GRCm39)	C314F	probably benign	Het
Pramel31	T	A	4: 144,089,025 (GRCm39)	D114E	probably damaging	Het
Prr5l	A	G	2: 101,565,050 (GRCm39)	F162S	probably damaging	Het
Rbfox2	T	C	15: 77,017,120 (GRCm39)	T17A	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,229,111 (GRCm39)		probably benign	Het
Ryr3	A	T	2: 112,470,626 (GRCm39)	F4610L	probably damaging	Het
Scp2	T	A	4: 107,928,554 (GRCm39)	R379W	probably damaging	Het
Serpina3j	A	G	12: 104,285,966 (GRCm39)	T374A	probably damaging	Het
Smad4	T	C	18: 73,781,975 (GRCm39)	Y429C	probably damaging	Het
Ttn	T	C	2: 76,565,025 (GRCm39)	T28401A	probably damaging	Het
Wdr49	A	G	3: 75,358,154 (GRCm39)	I260T	probably damaging	Het
Xirp1	T	C	9: 119,848,851 (GRCm39)	T11A	probably benign	Het
Zfp235	A	G	7: 23,840,157 (GRCm39)	D262G	probably damaging	Het

Other mutations in Lrpprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Lrpprc	APN	17	85,057,953 (GRCm39)	missense	possibly damaging	0.91
IGL01319:Lrpprc	APN	17	85,012,840 (GRCm39)	utr 3 prime	probably benign
IGL01380:Lrpprc	APN	17	85,030,158 (GRCm39)	missense	probably benign
IGL01560:Lrpprc	APN	17	85,015,547 (GRCm39)	missense	probably benign	0.07
IGL01582:Lrpprc	APN	17	85,061,971 (GRCm39)	missense	probably null	0.00
IGL01996:Lrpprc	APN	17	85,080,698 (GRCm39)	missense	probably benign
IGL02109:Lrpprc	APN	17	85,033,998 (GRCm39)	nonsense	probably null
IGL02163:Lrpprc	APN	17	85,060,900 (GRCm39)	missense	probably damaging	0.97
IGL02248:Lrpprc	APN	17	85,078,895 (GRCm39)	missense	probably damaging	0.99
IGL02503:Lrpprc	APN	17	85,033,767 (GRCm39)	missense	probably benign
IGL02545:Lrpprc	APN	17	85,082,853 (GRCm39)	missense	probably benign
IGL02570:Lrpprc	APN	17	85,057,981 (GRCm39)	missense	probably damaging	1.00
IGL02636:Lrpprc	APN	17	85,060,532 (GRCm39)	unclassified	probably benign
IGL02943:Lrpprc	APN	17	85,078,878 (GRCm39)	missense	probably benign	0.00
IGL03008:Lrpprc	APN	17	85,058,675 (GRCm39)	missense	probably benign	0.05
elusory	UTSW	17	85,020,215 (GRCm39)	missense	probably benign	0.01
phantom	UTSW	17	85,079,575 (GRCm39)	missense	probably damaging	1.00
R6807_Lrpprc_629	UTSW	17	85,056,531 (GRCm39)	missense	possibly damaging	0.93
Stereotype	UTSW	17	85,074,483 (GRCm39)	missense	probably damaging	1.00
thus	UTSW	17	85,078,355 (GRCm39)	missense	probably benign	0.01
P0023:Lrpprc	UTSW	17	85,033,766 (GRCm39)	missense	probably benign	0.00
R0027:Lrpprc	UTSW	17	85,074,435 (GRCm39)	nonsense	probably null
R0027:Lrpprc	UTSW	17	85,074,435 (GRCm39)	nonsense	probably null
R0302:Lrpprc	UTSW	17	85,047,506 (GRCm39)	missense	possibly damaging	0.76
R0389:Lrpprc	UTSW	17	85,060,540 (GRCm39)	critical splice donor site	probably null
R0448:Lrpprc	UTSW	17	85,078,322 (GRCm39)	missense	probably benign	0.09
R1396:Lrpprc	UTSW	17	85,033,731 (GRCm39)	missense	possibly damaging	0.68
R1759:Lrpprc	UTSW	17	85,047,509 (GRCm39)	missense	probably damaging	1.00
R2019:Lrpprc	UTSW	17	85,059,759 (GRCm39)	missense	possibly damaging	0.56
R2169:Lrpprc	UTSW	17	85,077,505 (GRCm39)	missense	probably benign	0.00
R2312:Lrpprc	UTSW	17	85,080,686 (GRCm39)	missense	probably damaging	0.96
R2319:Lrpprc	UTSW	17	85,033,818 (GRCm39)	missense	probably benign
R2568:Lrpprc	UTSW	17	85,034,077 (GRCm39)	missense	probably damaging	1.00
R3620:Lrpprc	UTSW	17	85,077,452 (GRCm39)	missense	probably benign	0.01
R3789:Lrpprc	UTSW	17	85,078,956 (GRCm39)	missense	probably benign	0.25
R3848:Lrpprc	UTSW	17	85,078,355 (GRCm39)	missense	probably benign	0.01
R3973:Lrpprc	UTSW	17	85,078,269 (GRCm39)	critical splice donor site	probably null
R4111:Lrpprc	UTSW	17	85,033,766 (GRCm39)	missense	probably benign	0.00
R4164:Lrpprc	UTSW	17	85,038,617 (GRCm39)	missense	possibly damaging	0.47
R4331:Lrpprc	UTSW	17	85,047,970 (GRCm39)	critical splice donor site	probably null
R4531:Lrpprc	UTSW	17	85,020,215 (GRCm39)	missense	probably benign	0.01
R4832:Lrpprc	UTSW	17	85,014,584 (GRCm39)	missense	probably benign	0.24
R4947:Lrpprc	UTSW	17	85,078,966 (GRCm39)	missense	probably benign	0.02
R5134:Lrpprc	UTSW	17	85,058,684 (GRCm39)	missense	probably benign	0.00
R5333:Lrpprc	UTSW	17	85,097,821 (GRCm39)	missense	probably benign	0.01
R5950:Lrpprc	UTSW	17	85,047,598 (GRCm39)	missense	possibly damaging	0.86
R5972:Lrpprc	UTSW	17	85,020,250 (GRCm39)	missense	possibly damaging	0.88
R6185:Lrpprc	UTSW	17	85,074,452 (GRCm39)	missense	probably benign
R6253:Lrpprc	UTSW	17	85,048,065 (GRCm39)	missense	probably benign	0.00
R6488:Lrpprc	UTSW	17	85,058,781 (GRCm39)	missense	probably damaging	1.00
R6807:Lrpprc	UTSW	17	85,056,531 (GRCm39)	missense	possibly damaging	0.93
R6911:Lrpprc	UTSW	17	85,063,711 (GRCm39)	missense	possibly damaging	0.67
R6933:Lrpprc	UTSW	17	85,030,131 (GRCm39)	missense	probably benign	0.42
R6955:Lrpprc	UTSW	17	85,084,417 (GRCm39)	missense	probably damaging	0.98
R7448:Lrpprc	UTSW	17	85,079,567 (GRCm39)	missense	probably damaging	0.99
R7727:Lrpprc	UTSW	17	85,084,375 (GRCm39)	missense	probably benign	0.00
R8003:Lrpprc	UTSW	17	85,059,745 (GRCm39)	missense	probably benign	0.01
R8178:Lrpprc	UTSW	17	85,079,575 (GRCm39)	missense	probably damaging	1.00
R8310:Lrpprc	UTSW	17	85,080,524 (GRCm39)	missense	probably damaging	1.00
R8322:Lrpprc	UTSW	17	85,047,496 (GRCm39)	critical splice donor site	probably null
R8389:Lrpprc	UTSW	17	85,080,742 (GRCm39)	missense	possibly damaging	0.79
R8560:Lrpprc	UTSW	17	85,047,495 (GRCm39)	splice site	probably benign
R8777:Lrpprc	UTSW	17	85,058,657 (GRCm39)	missense	probably benign	0.30
R8777-TAIL:Lrpprc	UTSW	17	85,058,657 (GRCm39)	missense	probably benign	0.30
R8868:Lrpprc	UTSW	17	85,078,920 (GRCm39)	missense	probably damaging	0.99
R8970:Lrpprc	UTSW	17	85,074,483 (GRCm39)	missense	probably damaging	1.00
R9042:Lrpprc	UTSW	17	85,059,736 (GRCm39)	critical splice donor site	probably null
R9493:Lrpprc	UTSW	17	85,015,548 (GRCm39)	missense	probably damaging	0.99
R9664:Lrpprc	UTSW	17	85,020,262 (GRCm39)	missense	probably damaging	0.99
X0026:Lrpprc	UTSW	17	85,018,090 (GRCm39)	missense	probably benign	0.42
Z1088:Lrpprc	UTSW	17	85,077,928 (GRCm39)	critical splice acceptor site	probably null
Z1088:Lrpprc	UTSW	17	85,039,212 (GRCm39)	nonsense	probably null
Z1176:Lrpprc	UTSW	17	85,077,859 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCTACGTTACACTGCTACACAC -3'
(R):5'- GGTCCAGGTAAATGGTGTCTC -3'

Sequencing Primer
(F):5'- TGCTACACACACTGACTGGTG -3'
(R):5'- CTGATGGAGAGAATCGTCAG -3'

Posted On

2015-01-11