Incidental Mutation 'R3013:Mkx'
ID257581
Institutional Source Beutler Lab
Gene Symbol Mkx
Ensembl Gene ENSMUSG00000061013
Gene Namemohawk homeobox
Synonyms9430023B20Rik, Irxl1
MMRRC Submission 040534-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3013 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6910459-7004780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6936929 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 334 (I334N)
Ref Sequence ENSEMBL: ENSMUSP00000078718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079788]
Predicted Effect probably damaging
Transcript: ENSMUST00000079788
AA Change: I334N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078718
Gene: ENSMUSG00000061013
AA Change: I334N

DomainStartEndE-ValueType
HOX 71 135 5.01e-4 SMART
low complexity region 158 171 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188926
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an IRX family-related homeobox protein that may play a role in cell adhesion. Studies in mice suggest that this protein may be a regulator of tendon development. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thin, hypoplastic tendons with reduced tensile strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 C T 8: 123,484,677 R126W probably benign Het
Alg10b T A 15: 90,227,556 I201N possibly damaging Het
Arid2 T C 15: 96,361,936 S326P probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bpifb5 T C 2: 154,228,855 S189P possibly damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Ccdc57 A G 11: 120,861,199 V852A probably benign Het
Ces1e G A 8: 93,203,287 S455L probably benign Het
Cyp4f14 T C 17: 32,909,165 K292R probably benign Het
Dnah7b T C 1: 46,188,687 probably null Het
Eml5 T C 12: 98,880,808 probably null Het
Gm13119 T A 4: 144,362,455 D114E probably damaging Het
Gtf2i T C 5: 134,295,504 probably benign Het
Hip1 T A 5: 135,435,039 E37V possibly damaging Het
Hspbp1 G T 7: 4,663,484 T299K probably benign Het
Lrpprc T C 17: 84,767,069 D470G probably benign Het
Obscn A T 11: 59,060,918 L4003Q probably damaging Het
Pcnx2 C A 8: 125,887,770 C314F probably benign Het
Prr5l A G 2: 101,734,705 F162S probably damaging Het
Rbfox2 T C 15: 77,132,920 T17A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A T 2: 112,640,281 F4610L probably damaging Het
Scp2 T A 4: 108,071,357 R379W probably damaging Het
Serpina3j A G 12: 104,319,707 T374A probably damaging Het
Smad4 T C 18: 73,648,904 Y429C probably damaging Het
Ttn T C 2: 76,734,681 T28401A probably damaging Het
Wdr49 A G 3: 75,450,847 I260T probably damaging Het
Xirp1 T C 9: 120,019,785 T11A probably benign Het
Zfp235 A G 7: 24,140,732 D262G probably damaging Het
Other mutations in Mkx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mkx APN 18 6937192 missense probably benign
IGL02478:Mkx APN 18 7002418 missense probably damaging 0.99
IGL02676:Mkx APN 18 7000640 missense probably benign 0.08
IGL02806:Mkx APN 18 6937025 missense probably damaging 1.00
R0766:Mkx UTSW 18 6937192 missense probably benign 0.05
R1273:Mkx UTSW 18 7002460 missense probably benign
R1312:Mkx UTSW 18 6937192 missense probably benign 0.05
R1496:Mkx UTSW 18 6992330 nonsense probably null
R2083:Mkx UTSW 18 6992855 missense probably damaging 0.99
R2196:Mkx UTSW 18 7000675 missense probably damaging 0.99
R4544:Mkx UTSW 18 7000651 missense probably damaging 1.00
R4646:Mkx UTSW 18 6992040 missense probably benign 0.43
R4798:Mkx UTSW 18 7002432 missense probably benign
R4887:Mkx UTSW 18 6992904 missense probably damaging 1.00
R4945:Mkx UTSW 18 7000657 missense possibly damaging 0.76
R6129:Mkx UTSW 18 6992888 missense probably damaging 0.98
R6267:Mkx UTSW 18 7000591 critical splice donor site probably null
R6271:Mkx UTSW 18 6937059 splice site probably null
R6296:Mkx UTSW 18 7000591 critical splice donor site probably null
R6569:Mkx UTSW 18 6992820 nonsense probably null
R7165:Mkx UTSW 18 7002525 missense probably damaging 0.97
R7365:Mkx UTSW 18 7000747 missense possibly damaging 0.85
Z1088:Mkx UTSW 18 6936975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGAGTCCTCTTCACCTC -3'
(R):5'- ACAGGTGAGCAAAATGAGTTTC -3'

Sequencing Primer
(F):5'- ACCTCTGCTTTGGCTCTTAGGATG -3'
(R):5'- TGGTAAACTGTCTCCAGGGCAC -3'
Posted On2015-01-11