Incidental Mutation 'R3015:Bltp1'
ID 257629
Institutional Source Beutler Lab
Gene Symbol Bltp1
Ensembl Gene ENSMUSG00000037270
Gene Name bridge-like lipid transfer protein family member 1
Synonyms FSA, 4932438A13Rik, Tweek
MMRRC Submission 040536-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3015 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 36917253-37107182 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36929611 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 76 (F76Y)
Ref Sequence ENSEMBL: ENSMUSP00000148720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000152564] [ENSMUST00000152881] [ENSMUST00000211820]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057272
AA Change: F76Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: F76Y

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136287
Predicted Effect probably damaging
Transcript: ENSMUST00000152564
AA Change: F76Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: F76Y

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152881
AA Change: F76Y

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118366
Gene: ENSMUSG00000037270
AA Change: F76Y

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198742
Predicted Effect probably damaging
Transcript: ENSMUST00000211820
AA Change: F76Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.1670 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 T C 6: 92,849,913 (GRCm39) H380R probably benign Het
Aff3 A T 1: 38,249,649 (GRCm39) I486N probably benign Het
Cfap44 A C 16: 44,230,832 (GRCm39) D271A probably benign Het
Dbndd2 T A 2: 164,330,270 (GRCm39) V34D probably damaging Het
Erc2 T A 14: 27,733,732 (GRCm39) probably null Het
Fcgbp T C 7: 27,774,838 (GRCm39) probably benign Het
Frem3 T C 8: 81,417,402 (GRCm39) S2036P probably damaging Het
Golph3l A G 3: 95,499,024 (GRCm39) probably benign Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Ifrd2 G A 9: 107,467,221 (GRCm39) G60S probably null Het
Ints9 T A 14: 65,187,727 (GRCm39) W3R probably benign Het
Jmjd1c A G 10: 66,993,711 (GRCm39) E64G probably damaging Het
Katnip T A 7: 125,465,512 (GRCm39) H1321Q probably damaging Het
Matn3 A C 12: 9,002,217 (GRCm39) Q143P probably damaging Het
Myo18a A T 11: 77,749,846 (GRCm39) probably benign Het
Nop9 T C 14: 55,988,631 (GRCm39) S358P probably benign Het
Pard3b T C 1: 62,384,037 (GRCm39) S801P probably damaging Het
Pax2 T C 19: 44,804,463 (GRCm39) F268L probably damaging Het
Pik3r1 A G 13: 101,823,771 (GRCm39) I538T probably damaging Het
Plekha8 T C 6: 54,599,107 (GRCm39) S214P probably benign Het
Ppme1 T C 7: 99,981,084 (GRCm39) H352R probably damaging Het
Ppp1r26 A C 2: 28,342,314 (GRCm39) D648A probably damaging Het
Prom1 C A 5: 44,191,733 (GRCm39) V337F probably damaging Het
Rapgef4 T C 2: 72,028,717 (GRCm39) I378T probably damaging Het
Rnf115 T C 3: 96,661,675 (GRCm39) S43P probably damaging Het
Rnf216 A G 5: 143,061,480 (GRCm39) probably null Het
Scn7a G T 2: 66,530,240 (GRCm39) Q702K probably benign Het
Shisal2b T A 13: 104,994,899 (GRCm39) I83F possibly damaging Het
Slc2a1 T A 4: 118,989,340 (GRCm39) N13K probably damaging Het
Tnr A G 1: 159,715,829 (GRCm39) I864V probably benign Het
Tspyl3 A T 2: 153,066,650 (GRCm39) M196K probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Umod T C 7: 119,071,763 (GRCm39) D326G probably damaging Het
Upf2 A G 2: 5,980,890 (GRCm39) D492G unknown Het
Vash1 A G 12: 86,732,194 (GRCm39) T126A probably benign Het
Vsig10l T A 7: 43,116,881 (GRCm39) I574K possibly damaging Het
Other mutations in Bltp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Bltp1 APN 3 37,065,876 (GRCm39) missense probably benign 0.00
IGL00434:Bltp1 APN 3 37,041,448 (GRCm39) missense probably damaging 0.98
IGL00640:Bltp1 APN 3 36,962,367 (GRCm39) missense probably damaging 1.00
IGL00693:Bltp1 APN 3 37,106,696 (GRCm39) utr 3 prime probably benign
IGL00721:Bltp1 APN 3 37,084,900 (GRCm39) splice site probably null
IGL00756:Bltp1 APN 3 36,962,367 (GRCm39) missense probably damaging 1.00
IGL00896:Bltp1 APN 3 37,093,611 (GRCm39) missense probably benign
IGL00902:Bltp1 APN 3 37,095,494 (GRCm39) missense probably damaging 1.00
IGL00980:Bltp1 APN 3 37,054,190 (GRCm39) missense probably damaging 1.00
IGL01019:Bltp1 APN 3 37,061,133 (GRCm39) critical splice acceptor site probably null
IGL01025:Bltp1 APN 3 37,100,429 (GRCm39) missense possibly damaging 0.89
IGL01306:Bltp1 APN 3 37,059,162 (GRCm39) splice site probably benign
IGL01370:Bltp1 APN 3 37,001,904 (GRCm39) missense probably benign 0.07
IGL01377:Bltp1 APN 3 37,027,601 (GRCm39) critical splice donor site probably null
IGL01401:Bltp1 APN 3 36,996,441 (GRCm39) missense probably benign
IGL01419:Bltp1 APN 3 37,102,270 (GRCm39) missense probably damaging 1.00
IGL01432:Bltp1 APN 3 37,057,908 (GRCm39) missense possibly damaging 0.87
IGL01433:Bltp1 APN 3 36,941,919 (GRCm39) missense probably damaging 1.00
IGL01452:Bltp1 APN 3 37,050,457 (GRCm39) unclassified probably benign
IGL01520:Bltp1 APN 3 37,027,409 (GRCm39) nonsense probably null
IGL01524:Bltp1 APN 3 36,996,531 (GRCm39) missense possibly damaging 0.90
IGL01628:Bltp1 APN 3 37,062,634 (GRCm39) missense probably damaging 1.00
IGL01638:Bltp1 APN 3 37,028,460 (GRCm39) missense probably damaging 1.00
IGL01650:Bltp1 APN 3 37,046,822 (GRCm39) splice site probably benign
IGL01717:Bltp1 APN 3 37,088,885 (GRCm39) missense probably benign
IGL01767:Bltp1 APN 3 37,095,512 (GRCm39) missense probably benign 0.29
IGL01813:Bltp1 APN 3 36,982,669 (GRCm39) missense possibly damaging 0.90
IGL01998:Bltp1 APN 3 37,011,165 (GRCm39) missense possibly damaging 0.49
IGL02172:Bltp1 APN 3 37,059,022 (GRCm39) missense probably damaging 0.99
IGL02197:Bltp1 APN 3 36,960,884 (GRCm39) missense probably damaging 1.00
IGL02248:Bltp1 APN 3 37,023,439 (GRCm39) critical splice donor site probably null
IGL02273:Bltp1 APN 3 36,975,586 (GRCm39) splice site probably benign
IGL02403:Bltp1 APN 3 37,084,813 (GRCm39) missense probably benign
IGL02492:Bltp1 APN 3 37,102,262 (GRCm39) missense probably benign 0.04
IGL02517:Bltp1 APN 3 37,013,017 (GRCm39) missense probably damaging 1.00
IGL02519:Bltp1 APN 3 36,949,464 (GRCm39) missense probably damaging 1.00
IGL02586:Bltp1 APN 3 37,098,757 (GRCm39) nonsense probably null
IGL02620:Bltp1 APN 3 37,090,094 (GRCm39) missense possibly damaging 0.95
IGL02621:Bltp1 APN 3 37,095,633 (GRCm39) splice site probably benign
IGL02670:Bltp1 APN 3 37,021,454 (GRCm39) nonsense probably null
IGL02806:Bltp1 APN 3 37,000,643 (GRCm39) missense possibly damaging 0.95
IGL02985:Bltp1 APN 3 37,012,906 (GRCm39) missense probably damaging 0.99
IGL03004:Bltp1 APN 3 37,019,826 (GRCm39) splice site probably benign
IGL03037:Bltp1 APN 3 37,023,356 (GRCm39) missense probably benign 0.23
IGL03037:Bltp1 APN 3 37,023,357 (GRCm39) missense probably damaging 1.00
IGL03062:Bltp1 APN 3 37,092,666 (GRCm39) splice site probably benign
IGL03137:Bltp1 APN 3 37,088,751 (GRCm39) missense probably damaging 0.98
IGL03150:Bltp1 APN 3 37,002,215 (GRCm39) missense probably damaging 1.00
IGL03204:Bltp1 APN 3 37,105,083 (GRCm39) splice site probably benign
IGL03207:Bltp1 APN 3 37,004,145 (GRCm39) missense possibly damaging 0.73
IGL03256:Bltp1 APN 3 36,960,832 (GRCm39) splice site probably benign
IGL03264:Bltp1 APN 3 37,056,784 (GRCm39) missense probably damaging 1.00
IGL03265:Bltp1 APN 3 37,102,140 (GRCm39) missense probably benign 0.00
IGL03303:Bltp1 APN 3 36,924,226 (GRCm39) missense possibly damaging 0.90
admonished UTSW 3 37,002,453 (GRCm39) missense probably damaging 1.00
alerted UTSW 3 37,087,414 (GRCm39) missense possibly damaging 0.85
informed UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
resolved UTSW 3 36,975,370 (GRCm39) missense possibly damaging 0.60
tipped UTSW 3 37,042,234 (GRCm39) missense possibly damaging 0.81
warned UTSW 3 37,019,770 (GRCm39) missense probably damaging 1.00
FR4340:Bltp1 UTSW 3 37,104,901 (GRCm39) critical splice acceptor site probably benign
FR4737:Bltp1 UTSW 3 37,104,903 (GRCm39) critical splice acceptor site probably benign
PIT4515001:Bltp1 UTSW 3 37,028,385 (GRCm39) missense probably damaging 1.00
R0035:Bltp1 UTSW 3 37,041,747 (GRCm39) nonsense probably null
R0047:Bltp1 UTSW 3 36,962,341 (GRCm39) missense possibly damaging 0.83
R0047:Bltp1 UTSW 3 36,962,341 (GRCm39) missense possibly damaging 0.83
R0068:Bltp1 UTSW 3 37,006,370 (GRCm39) missense probably benign 0.28
R0068:Bltp1 UTSW 3 37,006,370 (GRCm39) missense probably benign 0.28
R0092:Bltp1 UTSW 3 37,082,308 (GRCm39) missense probably benign 0.41
R0233:Bltp1 UTSW 3 37,002,712 (GRCm39) nonsense probably null
R0233:Bltp1 UTSW 3 37,002,712 (GRCm39) nonsense probably null
R0256:Bltp1 UTSW 3 36,971,922 (GRCm39) missense probably benign 0.01
R0277:Bltp1 UTSW 3 36,997,331 (GRCm39) nonsense probably null
R0321:Bltp1 UTSW 3 36,960,937 (GRCm39) splice site probably null
R0323:Bltp1 UTSW 3 36,997,331 (GRCm39) nonsense probably null
R0335:Bltp1 UTSW 3 37,023,301 (GRCm39) missense probably damaging 1.00
R0375:Bltp1 UTSW 3 37,100,401 (GRCm39) missense probably damaging 0.99
R0437:Bltp1 UTSW 3 37,043,953 (GRCm39) missense possibly damaging 0.81
R0445:Bltp1 UTSW 3 37,054,214 (GRCm39) missense probably damaging 0.99
R0496:Bltp1 UTSW 3 37,041,784 (GRCm39) missense probably damaging 1.00
R0531:Bltp1 UTSW 3 37,090,974 (GRCm39) missense probably damaging 1.00
R0543:Bltp1 UTSW 3 37,050,607 (GRCm39) missense probably benign 0.22
R0545:Bltp1 UTSW 3 37,041,839 (GRCm39) splice site probably benign
R0674:Bltp1 UTSW 3 37,098,775 (GRCm39) missense possibly damaging 0.86
R0745:Bltp1 UTSW 3 36,982,612 (GRCm39) missense probably damaging 1.00
R0755:Bltp1 UTSW 3 37,000,513 (GRCm39) missense probably damaging 1.00
R0785:Bltp1 UTSW 3 37,013,483 (GRCm39) splice site probably benign
R1056:Bltp1 UTSW 3 37,098,829 (GRCm39) missense probably benign 0.44
R1056:Bltp1 UTSW 3 37,037,602 (GRCm39) missense possibly damaging 0.69
R1080:Bltp1 UTSW 3 37,042,404 (GRCm39) missense probably damaging 1.00
R1103:Bltp1 UTSW 3 37,050,672 (GRCm39) missense probably benign
R1119:Bltp1 UTSW 3 37,041,194 (GRCm39) missense probably damaging 1.00
R1170:Bltp1 UTSW 3 37,098,780 (GRCm39) missense probably damaging 0.98
R1183:Bltp1 UTSW 3 36,949,452 (GRCm39) missense possibly damaging 0.51
R1186:Bltp1 UTSW 3 37,050,461 (GRCm39) unclassified probably benign
R1201:Bltp1 UTSW 3 37,002,524 (GRCm39) missense probably benign
R1219:Bltp1 UTSW 3 37,000,619 (GRCm39) nonsense probably null
R1270:Bltp1 UTSW 3 37,006,333 (GRCm39) missense probably damaging 1.00
R1273:Bltp1 UTSW 3 37,041,359 (GRCm39) missense probably damaging 1.00
R1338:Bltp1 UTSW 3 37,106,684 (GRCm39) missense unknown
R1364:Bltp1 UTSW 3 37,041,179 (GRCm39) missense probably damaging 1.00
R1437:Bltp1 UTSW 3 36,996,578 (GRCm39) missense possibly damaging 0.65
R1447:Bltp1 UTSW 3 37,019,735 (GRCm39) missense probably damaging 0.98
R1467:Bltp1 UTSW 3 37,090,094 (GRCm39) missense probably damaging 0.99
R1467:Bltp1 UTSW 3 37,090,094 (GRCm39) missense probably damaging 0.99
R1470:Bltp1 UTSW 3 37,052,480 (GRCm39) missense probably benign 0.31
R1470:Bltp1 UTSW 3 37,052,480 (GRCm39) missense probably benign 0.31
R1481:Bltp1 UTSW 3 37,062,583 (GRCm39) missense probably damaging 0.99
R1528:Bltp1 UTSW 3 37,106,684 (GRCm39) missense unknown
R1533:Bltp1 UTSW 3 37,095,524 (GRCm39) missense probably damaging 1.00
R1546:Bltp1 UTSW 3 36,924,205 (GRCm39) missense possibly damaging 0.64
R1606:Bltp1 UTSW 3 36,996,548 (GRCm39) missense probably damaging 1.00
R1638:Bltp1 UTSW 3 37,089,961 (GRCm39) nonsense probably null
R1772:Bltp1 UTSW 3 37,013,581 (GRCm39) missense probably damaging 1.00
R1896:Bltp1 UTSW 3 36,962,380 (GRCm39) nonsense probably null
R1919:Bltp1 UTSW 3 37,061,132 (GRCm39) critical splice acceptor site probably null
R1983:Bltp1 UTSW 3 36,942,014 (GRCm39) missense probably null 1.00
R1987:Bltp1 UTSW 3 37,008,134 (GRCm39) critical splice donor site probably null
R1992:Bltp1 UTSW 3 37,054,181 (GRCm39) missense probably benign 0.32
R1999:Bltp1 UTSW 3 36,962,360 (GRCm39) missense probably damaging 1.00
R2004:Bltp1 UTSW 3 36,949,527 (GRCm39) missense possibly damaging 0.77
R2010:Bltp1 UTSW 3 36,982,700 (GRCm39) missense probably benign 0.09
R2027:Bltp1 UTSW 3 37,102,110 (GRCm39) splice site probably benign
R2039:Bltp1 UTSW 3 37,058,027 (GRCm39) missense possibly damaging 0.66
R2054:Bltp1 UTSW 3 37,002,002 (GRCm39) missense probably benign 0.01
R2089:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,042,405 (GRCm39) missense probably damaging 1.00
R2091:Bltp1 UTSW 3 37,008,119 (GRCm39) missense probably damaging 1.00
R2220:Bltp1 UTSW 3 36,929,679 (GRCm39) critical splice donor site probably null
R2374:Bltp1 UTSW 3 36,939,545 (GRCm39) missense probably benign 0.00
R2437:Bltp1 UTSW 3 37,012,834 (GRCm39) splice site probably null
R2860:Bltp1 UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
R2861:Bltp1 UTSW 3 37,019,998 (GRCm39) missense probably damaging 1.00
R2909:Bltp1 UTSW 3 37,002,102 (GRCm39) missense probably damaging 1.00
R2925:Bltp1 UTSW 3 37,061,271 (GRCm39) missense probably damaging 0.99
R2940:Bltp1 UTSW 3 37,012,954 (GRCm39) missense probably damaging 1.00
R3086:Bltp1 UTSW 3 37,065,852 (GRCm39) missense possibly damaging 0.56
R3159:Bltp1 UTSW 3 37,013,564 (GRCm39) missense probably benign 0.17
R3440:Bltp1 UTSW 3 37,096,061 (GRCm39) nonsense probably null
R3703:Bltp1 UTSW 3 37,041,730 (GRCm39) missense probably damaging 1.00
R3705:Bltp1 UTSW 3 37,041,730 (GRCm39) missense probably damaging 1.00
R3795:Bltp1 UTSW 3 37,084,714 (GRCm39) missense probably benign 0.30
R3820:Bltp1 UTSW 3 37,094,583 (GRCm39) missense probably damaging 1.00
R3862:Bltp1 UTSW 3 36,939,547 (GRCm39) missense possibly damaging 0.73
R3944:Bltp1 UTSW 3 37,084,210 (GRCm39) missense possibly damaging 0.90
R4020:Bltp1 UTSW 3 37,066,724 (GRCm39) intron probably benign
R4091:Bltp1 UTSW 3 37,084,738 (GRCm39) missense probably benign 0.00
R4159:Bltp1 UTSW 3 36,985,232 (GRCm39) missense probably benign 0.00
R4231:Bltp1 UTSW 3 36,974,385 (GRCm39) missense probably benign 0.10
R4368:Bltp1 UTSW 3 37,042,296 (GRCm39) nonsense probably null
R4413:Bltp1 UTSW 3 37,012,830 (GRCm39) splice site probably null
R4475:Bltp1 UTSW 3 37,094,544 (GRCm39) missense probably damaging 1.00
R4488:Bltp1 UTSW 3 37,058,082 (GRCm39) missense probably null 0.93
R4489:Bltp1 UTSW 3 37,058,082 (GRCm39) missense probably null 0.93
R4516:Bltp1 UTSW 3 36,949,460 (GRCm39) missense possibly damaging 0.90
R4580:Bltp1 UTSW 3 37,084,174 (GRCm39) missense probably benign 0.02
R4672:Bltp1 UTSW 3 36,944,139 (GRCm39) makesense probably null
R4705:Bltp1 UTSW 3 37,096,038 (GRCm39) missense probably benign 0.03
R4735:Bltp1 UTSW 3 37,059,116 (GRCm39) missense possibly damaging 0.84
R4741:Bltp1 UTSW 3 36,996,524 (GRCm39) missense probably damaging 0.99
R4754:Bltp1 UTSW 3 37,076,615 (GRCm39) nonsense probably null
R4778:Bltp1 UTSW 3 36,991,214 (GRCm39) missense possibly damaging 0.90
R4833:Bltp1 UTSW 3 37,019,117 (GRCm39) missense probably damaging 0.96
R4896:Bltp1 UTSW 3 37,020,086 (GRCm39) missense probably damaging 1.00
R4910:Bltp1 UTSW 3 37,052,348 (GRCm39) missense probably damaging 1.00
R4922:Bltp1 UTSW 3 37,041,314 (GRCm39) missense probably damaging 1.00
R4941:Bltp1 UTSW 3 36,974,050 (GRCm39) missense probably benign 0.41
R4941:Bltp1 UTSW 3 36,971,851 (GRCm39) missense probably damaging 1.00
R4980:Bltp1 UTSW 3 36,997,461 (GRCm39) missense probably damaging 1.00
R5030:Bltp1 UTSW 3 36,997,548 (GRCm39) intron probably benign
R5049:Bltp1 UTSW 3 37,095,539 (GRCm39) missense probably damaging 1.00
R5049:Bltp1 UTSW 3 37,094,655 (GRCm39) intron probably benign
R5089:Bltp1 UTSW 3 37,041,651 (GRCm39) missense probably benign 0.02
R5092:Bltp1 UTSW 3 37,054,234 (GRCm39) missense probably benign 0.14
R5122:Bltp1 UTSW 3 37,088,906 (GRCm39) splice site probably null
R5210:Bltp1 UTSW 3 37,087,414 (GRCm39) missense possibly damaging 0.85
R5246:Bltp1 UTSW 3 37,102,199 (GRCm39) missense probably damaging 1.00
R5289:Bltp1 UTSW 3 37,054,258 (GRCm39) missense probably damaging 0.97
R5348:Bltp1 UTSW 3 37,102,295 (GRCm39) missense probably damaging 1.00
R5394:Bltp1 UTSW 3 36,971,817 (GRCm39) missense probably damaging 1.00
R5434:Bltp1 UTSW 3 36,929,665 (GRCm39) missense probably damaging 1.00
R5667:Bltp1 UTSW 3 36,971,826 (GRCm39) missense probably benign 0.00
R5686:Bltp1 UTSW 3 36,971,809 (GRCm39) missense probably benign 0.00
R5701:Bltp1 UTSW 3 36,975,509 (GRCm39) missense probably benign 0.10
R5778:Bltp1 UTSW 3 37,012,863 (GRCm39) missense probably damaging 1.00
R5787:Bltp1 UTSW 3 37,046,882 (GRCm39) splice site probably null
R5800:Bltp1 UTSW 3 37,106,592 (GRCm39) missense probably damaging 1.00
R5819:Bltp1 UTSW 3 37,102,749 (GRCm39) missense probably benign 0.12
R5820:Bltp1 UTSW 3 37,093,675 (GRCm39) missense probably benign 0.00
R5952:Bltp1 UTSW 3 37,019,770 (GRCm39) missense probably damaging 1.00
R5975:Bltp1 UTSW 3 37,023,370 (GRCm39) missense possibly damaging 0.64
R5996:Bltp1 UTSW 3 36,985,265 (GRCm39) missense probably benign 0.07
R6192:Bltp1 UTSW 3 37,042,318 (GRCm39) missense probably benign 0.00
R6225:Bltp1 UTSW 3 37,002,453 (GRCm39) missense probably damaging 1.00
R6234:Bltp1 UTSW 3 37,037,620 (GRCm39) missense probably benign 0.00
R6244:Bltp1 UTSW 3 37,011,148 (GRCm39) missense probably benign
R6263:Bltp1 UTSW 3 36,985,260 (GRCm39) missense probably benign 0.06
R6351:Bltp1 UTSW 3 36,962,377 (GRCm39) missense probably damaging 1.00
R6380:Bltp1 UTSW 3 37,087,456 (GRCm39) missense probably benign 0.19
R6468:Bltp1 UTSW 3 37,062,592 (GRCm39) missense probably damaging 1.00
R6759:Bltp1 UTSW 3 37,042,234 (GRCm39) missense possibly damaging 0.81
R6792:Bltp1 UTSW 3 37,065,715 (GRCm39) critical splice acceptor site probably null
R6809:Bltp1 UTSW 3 36,928,431 (GRCm39) missense probably damaging 0.98
R6841:Bltp1 UTSW 3 37,075,630 (GRCm39) missense probably damaging 1.00
R6959:Bltp1 UTSW 3 37,021,338 (GRCm39) missense probably damaging 1.00
R7102:Bltp1 UTSW 3 36,994,947 (GRCm39) missense probably damaging 0.99
R7188:Bltp1 UTSW 3 37,004,162 (GRCm39) missense probably benign 0.06
R7212:Bltp1 UTSW 3 37,102,158 (GRCm39) missense
R7425:Bltp1 UTSW 3 37,037,543 (GRCm39) missense probably benign 0.02
R7425:Bltp1 UTSW 3 37,002,490 (GRCm39) missense probably benign
R7451:Bltp1 UTSW 3 37,076,956 (GRCm39) splice site probably null
R7604:Bltp1 UTSW 3 37,003,992 (GRCm39) splice site probably null
R7622:Bltp1 UTSW 3 37,002,562 (GRCm39) nonsense probably null
R7671:Bltp1 UTSW 3 36,997,380 (GRCm39) missense probably damaging 0.99
R7699:Bltp1 UTSW 3 37,080,303 (GRCm39) missense probably benign 0.00
R7699:Bltp1 UTSW 3 37,028,321 (GRCm39) missense possibly damaging 0.67
R7700:Bltp1 UTSW 3 37,028,321 (GRCm39) missense possibly damaging 0.67
R7700:Bltp1 UTSW 3 37,080,303 (GRCm39) missense probably benign 0.00
R7748:Bltp1 UTSW 3 37,013,484 (GRCm39) critical splice acceptor site probably null
R7767:Bltp1 UTSW 3 36,974,436 (GRCm39) critical splice donor site probably null
R7787:Bltp1 UTSW 3 36,939,557 (GRCm39) missense probably damaging 1.00
R7830:Bltp1 UTSW 3 37,019,081 (GRCm39) frame shift probably null
R7849:Bltp1 UTSW 3 37,080,477 (GRCm39) missense
R7912:Bltp1 UTSW 3 37,061,218 (GRCm39) missense probably damaging 0.99
R7914:Bltp1 UTSW 3 37,000,432 (GRCm39) missense probably benign 0.13
R7945:Bltp1 UTSW 3 37,020,042 (GRCm39) missense probably benign 0.03
R8039:Bltp1 UTSW 3 36,997,363 (GRCm39) missense probably benign 0.12
R8101:Bltp1 UTSW 3 37,062,651 (GRCm39) missense probably damaging 1.00
R8143:Bltp1 UTSW 3 37,000,657 (GRCm39) critical splice donor site probably null
R8145:Bltp1 UTSW 3 37,052,416 (GRCm39) missense probably damaging 1.00
R8171:Bltp1 UTSW 3 37,029,862 (GRCm39) missense probably benign 0.00
R8210:Bltp1 UTSW 3 37,067,030 (GRCm39) missense
R8250:Bltp1 UTSW 3 36,971,811 (GRCm39) missense probably damaging 0.99
R8369:Bltp1 UTSW 3 37,065,752 (GRCm39) missense
R8478:Bltp1 UTSW 3 37,087,426 (GRCm39) missense possibly damaging 0.74
R8558:Bltp1 UTSW 3 37,102,750 (GRCm39) missense
R8688:Bltp1 UTSW 3 37,090,066 (GRCm39) missense
R8724:Bltp1 UTSW 3 36,945,042 (GRCm39) missense probably damaging 0.99
R8818:Bltp1 UTSW 3 37,050,697 (GRCm39) missense possibly damaging 0.60
R8869:Bltp1 UTSW 3 37,013,007 (GRCm39) missense probably damaging 0.99
R8887:Bltp1 UTSW 3 37,087,503 (GRCm39) missense possibly damaging 0.95
R8899:Bltp1 UTSW 3 37,042,429 (GRCm39) missense probably damaging 1.00
R8907:Bltp1 UTSW 3 37,002,295 (GRCm39) nonsense probably null
R8960:Bltp1 UTSW 3 37,067,132 (GRCm39) missense probably damaging 1.00
R8990:Bltp1 UTSW 3 36,975,370 (GRCm39) missense possibly damaging 0.60
R9021:Bltp1 UTSW 3 37,052,493 (GRCm39) missense probably benign 0.00
R9048:Bltp1 UTSW 3 37,065,926 (GRCm39) missense
R9100:Bltp1 UTSW 3 37,098,907 (GRCm39) missense
R9166:Bltp1 UTSW 3 37,041,516 (GRCm39) missense probably damaging 1.00
R9176:Bltp1 UTSW 3 37,010,852 (GRCm39) missense possibly damaging 0.82
R9202:Bltp1 UTSW 3 36,944,970 (GRCm39) missense probably benign
R9303:Bltp1 UTSW 3 37,098,969 (GRCm39) missense
R9305:Bltp1 UTSW 3 37,098,969 (GRCm39) missense
R9332:Bltp1 UTSW 3 37,104,989 (GRCm39) missense
R9362:Bltp1 UTSW 3 37,011,162 (GRCm39) missense probably benign
R9493:Bltp1 UTSW 3 37,065,885 (GRCm39) missense
R9534:Bltp1 UTSW 3 37,052,419 (GRCm39) missense probably benign 0.01
R9569:Bltp1 UTSW 3 37,066,770 (GRCm39) missense
R9593:Bltp1 UTSW 3 37,002,090 (GRCm39) missense probably damaging 1.00
R9600:Bltp1 UTSW 3 37,095,565 (GRCm39) nonsense probably null
R9733:Bltp1 UTSW 3 37,102,732 (GRCm39) missense
R9751:Bltp1 UTSW 3 37,065,889 (GRCm39) missense
RF013:Bltp1 UTSW 3 37,104,906 (GRCm39) critical splice acceptor site probably benign
RF015:Bltp1 UTSW 3 37,104,897 (GRCm39) critical splice acceptor site probably benign
RF021:Bltp1 UTSW 3 37,104,897 (GRCm39) critical splice acceptor site probably benign
RF023:Bltp1 UTSW 3 37,104,909 (GRCm39) critical splice acceptor site probably benign
RF034:Bltp1 UTSW 3 37,104,909 (GRCm39) critical splice acceptor site probably benign
RF035:Bltp1 UTSW 3 37,104,907 (GRCm39) critical splice acceptor site probably benign
RF055:Bltp1 UTSW 3 37,104,906 (GRCm39) critical splice acceptor site probably benign
X0050:Bltp1 UTSW 3 37,011,277 (GRCm39) missense probably damaging 1.00
Z1088:Bltp1 UTSW 3 37,041,716 (GRCm39) missense probably damaging 1.00
Z1177:Bltp1 UTSW 3 37,037,589 (GRCm39) missense possibly damaging 0.88
Z1177:Bltp1 UTSW 3 36,974,099 (GRCm39) missense probably benign
Z1177:Bltp1 UTSW 3 37,090,856 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCAGTCCGTAGTGGTTTGATCC -3'
(R):5'- TCACTTCTATAAACTGCCAGCTAAG -3'

Sequencing Primer
(F):5'- AAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CTGCCAGCTAAGAAAAATTTTTCC -3'
Posted On 2015-01-11