Incidental Mutation 'R3015:Slc2a1'
ID257632
Institutional Source Beutler Lab
Gene Symbol Slc2a1
Ensembl Gene ENSMUSG00000028645
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 1
SynonymsGlut1, Glut-1
MMRRC Submission 040536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3015 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location119108711-119137983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119132143 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 13 (N13K)
Ref Sequence ENSEMBL: ENSMUSP00000146958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030398] [ENSMUST00000134105] [ENSMUST00000144329] [ENSMUST00000174372] [ENSMUST00000208090]
Predicted Effect probably damaging
Transcript: ENSMUST00000030398
AA Change: N45K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030398
Gene: ENSMUSG00000028645
AA Change: N45K

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 467 1e-164 PFAM
Pfam:MFS_1 24 418 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134105
AA Change: N41K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118641
Gene: ENSMUSG00000028645
AA Change: N41K

DomainStartEndE-ValueType
Pfam:Sugar_tr 12 128 7.7e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143801
Predicted Effect probably benign
Transcript: ENSMUST00000144329
AA Change: N33K

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134126
Gene: ENSMUSG00000028645
AA Change: N33K

DomainStartEndE-ValueType
Pfam:Sugar_tr 4 123 1.5e-35 PFAM
Pfam:MFS_1 5 123 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157927
Predicted Effect possibly damaging
Transcript: ENSMUST00000174372
AA Change: N45K

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134714
Gene: ENSMUSG00000028645
AA Change: N45K

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 173 9.3e-53 PFAM
Pfam:MFS_1 18 172 1.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208090
AA Change: N13K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major glucose transporter in the mammalian blood-brain barrier. The encoded protein is found primarily in the cell membrane and on the cell surface, where it can also function as a receptor for human T-cell leukemia virus (HTLV) I and II. Mutations in this gene have been found in a family with paroxysmal exertion-induced dyskinesia. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null embryos are small, lack visibly detectable eyes, show a diminutive rostral embryonic pole and an overall developmental delay, and die at E10-E14. Heterozygotes show spontaneous seizures, impaired motor performance, hypoglycorrhachia, microencephaly, and reduced brain glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,875,462 F76Y probably damaging Het
Adamts9 T C 6: 92,872,932 H380R probably benign Het
Aff3 A T 1: 38,210,568 I486N probably benign Het
Cfap44 A C 16: 44,410,469 D271A probably benign Het
D430042O09Rik T A 7: 125,866,340 H1321Q probably damaging Het
Dbndd2 T A 2: 164,488,350 V34D probably damaging Het
Erc2 T A 14: 28,011,775 probably null Het
Fam159b T A 13: 104,858,391 I83F possibly damaging Het
Fcgbp T C 7: 28,075,413 probably benign Het
Frem3 T C 8: 80,690,773 S2036P probably damaging Het
Golph3l A G 3: 95,591,713 probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ifrd2 G A 9: 107,590,022 G60S probably null Het
Ints9 T A 14: 64,950,278 W3R probably benign Het
Jmjd1c A G 10: 67,157,932 E64G probably damaging Het
Matn3 A C 12: 8,952,217 Q143P probably damaging Het
Myo18a A T 11: 77,859,020 probably benign Het
Nop9 T C 14: 55,751,174 S358P probably benign Het
Pard3b T C 1: 62,344,878 S801P probably damaging Het
Pax2 T C 19: 44,816,024 F268L probably damaging Het
Pik3r1 A G 13: 101,687,263 I538T probably damaging Het
Plekha8 T C 6: 54,622,122 S214P probably benign Het
Ppme1 T C 7: 100,331,877 H352R probably damaging Het
Ppp1r26 A C 2: 28,452,302 D648A probably damaging Het
Prom1 C A 5: 44,034,391 V337F probably damaging Het
Rapgef4 T C 2: 72,198,373 I378T probably damaging Het
Rnf115 T C 3: 96,754,359 S43P probably damaging Het
Rnf216 A G 5: 143,075,725 probably null Het
Scn7a G T 2: 66,699,896 Q702K probably benign Het
Tnr A G 1: 159,888,259 I864V probably benign Het
Tspyl3 A T 2: 153,224,730 M196K probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Umod T C 7: 119,472,540 D326G probably damaging Het
Upf2 A G 2: 5,976,079 D492G unknown Het
Vash1 A G 12: 86,685,420 T126A probably benign Het
Vsig10l T A 7: 43,467,457 I574K possibly damaging Het
Other mutations in Slc2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Slc2a1 APN 4 119132238 missense possibly damaging 0.94
IGL01876:Slc2a1 APN 4 119133378 missense probably benign 0.11
IGL02355:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
IGL02362:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
R1076:Slc2a1 UTSW 4 119134448 missense probably damaging 0.98
R1561:Slc2a1 UTSW 4 119136409 missense possibly damaging 0.86
R1616:Slc2a1 UTSW 4 119136306 missense probably damaging 1.00
R4166:Slc2a1 UTSW 4 119133116 missense probably damaging 0.97
R4795:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R4796:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R6025:Slc2a1 UTSW 4 119136342 missense possibly damaging 0.68
R7403:Slc2a1 UTSW 4 119132555 missense probably damaging 1.00
R7429:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7430:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7524:Slc2a1 UTSW 4 119132612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCTCAGAGTCTTGACCAC -3'
(R):5'- AGACAGGATGACACAGGCTC -3'

Sequencing Primer
(F):5'- TCAGAGTCTTGACCACCTTAGGAG -3'
(R):5'- GGATGACACAGGCTCCCCAAG -3'
Posted On2015-01-11