Incidental Mutation 'R3018:Moxd2'
ID257686
Institutional Source Beutler Lab
Gene Symbol Moxd2
Ensembl Gene ENSMUSG00000029885
Gene Namemonooxygenase, DBH-like 2
SynonymsDbhl1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3018 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40878794-40887494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40878886 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 590 (T590S)
Ref Sequence ENSEMBL: ENSMUSP00000031937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031937]
Predicted Effect probably benign
Transcript: ENSMUST00000031937
AA Change: T590S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031937
Gene: ENSMUSG00000029885
AA Change: T590S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
DoH 66 156 1.43e-12 SMART
Pfam:Cu2_monooxygen 192 316 8.3e-39 PFAM
Pfam:Cu2_monoox_C 336 493 1.8e-37 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T C 1: 127,749,116 V126A probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Dnm3 T A 1: 162,321,759 K206* probably null Het
Grxcr1 C T 5: 68,110,517 S203F probably damaging Het
Matn3 A T 12: 8,963,578 D420V probably benign Het
Mlf2 G T 6: 124,932,504 M48I probably benign Het
Myh2 A G 11: 67,179,584 D451G possibly damaging Het
Neurod4 T C 10: 130,270,955 E150G probably damaging Het
Nynrin A T 14: 55,863,410 E219V probably benign Het
Rad51ap1 T C 6: 126,939,522 probably null Het
Rpl38 T A 11: 114,668,935 F11L possibly damaging Het
Serinc5 T C 13: 92,688,681 M206T probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tnk1 C T 11: 69,854,911 probably benign Het
Trim41 G T 11: 48,807,694 R482S probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zfp292 G A 4: 34,808,814 T1410I probably damaging Het
Other mutations in Moxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Moxd2 APN 6 40884179 splice site probably benign
IGL02113:Moxd2 APN 6 40885404 missense probably benign 0.06
IGL02223:Moxd2 APN 6 40885033 missense probably damaging 1.00
IGL03204:Moxd2 APN 6 40887305 missense probably benign 0.04
IGL03385:Moxd2 APN 6 40879018 missense probably damaging 1.00
R0084:Moxd2 UTSW 6 40879408 missense probably null 0.01
R1213:Moxd2 UTSW 6 40891897 unclassified probably benign
R1326:Moxd2 UTSW 6 40880354 missense probably benign 0.00
R1652:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
R1940:Moxd2 UTSW 6 40883532 missense probably damaging 1.00
R2040:Moxd2 UTSW 6 40884953 splice site probably null
R2088:Moxd2 UTSW 6 40884967 missense probably damaging 1.00
R3962:Moxd2 UTSW 6 40885397 missense probably benign
R4248:Moxd2 UTSW 6 40878999 missense probably damaging 1.00
R4438:Moxd2 UTSW 6 40884062 missense probably damaging 1.00
R4715:Moxd2 UTSW 6 40887247 missense probably damaging 1.00
R4732:Moxd2 UTSW 6 40878859 missense probably benign
R4733:Moxd2 UTSW 6 40878859 missense probably benign
R4760:Moxd2 UTSW 6 40891603 missense probably benign 0.06
R4851:Moxd2 UTSW 6 40878822 missense probably damaging 1.00
R5087:Moxd2 UTSW 6 40879336 missense probably damaging 1.00
R5187:Moxd2 UTSW 6 40879337 missense probably benign 0.18
R5339:Moxd2 UTSW 6 40885420 missense probably damaging 1.00
R5452:Moxd2 UTSW 6 40882114 splice site probably null
R5860:Moxd2 UTSW 6 40880407 missense probably damaging 1.00
R5973:Moxd2 UTSW 6 40878810 missense probably damaging 0.96
R6015:Moxd2 UTSW 6 40883754 missense probably damaging 1.00
R6316:Moxd2 UTSW 6 40883547 missense probably damaging 1.00
R7561:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
X0052:Moxd2 UTSW 6 40882528 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCGGTTATGGAAAGTGTCAAAAGG -3'
(R):5'- GGGGTGGCACAGTAAAGTTTC -3'

Sequencing Primer
(F):5'- GACACTTAGAGGGGTCAAATTGGC -3'
(R):5'- GGTAGGGATATTTCTGAATCTACTCC -3'
Posted On2015-01-11